Ptp4a3 (NM_008975) Mouse Untagged Clone

SKU
MC205828
Ptp4a3 (untagged) - Mouse protein tyrosine phosphatase 4a3 (Ptp4a3), transcript variant 2, (10ug)
  $300.00
In Stock*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Ptp4a3
Synonyms AV088979; pPtp4a3; Prl-3
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC027445
GTGCAGCCCTTGCTGGCTAGTCCCCTCTGGGTCCCCGGAGGAGGCATGGCCCGCATGAACCGGCCTGCGC CTGTGGAGGTGAGCTACCGGCACATGCGCTTCCTCATCACCCACAACCCCAGCAATGCCACCCTCAGCAC GTTCATCGAGGACCTGAAGAAGTACGGGGCTACCACTGTGGTGCGCGTGTGTGAAGTGACCTATGACAAG ACCCCCCTGGAGAAGGACGGCATCACTGTTGTGGACTGGCCCTTTGATGATGGAGCGCCCCCTCCTGGCA AAGTGGTAGAGGACTGGCTGAGCCTGCTGAAGGCCAAGTTCTACAATGACCCGGGAAGCTGCGTAGCTGT GCACTGTGTGGCGGGCCTGGGAAGGGCCCCAGTGCTCGTGGCTCTCGCCCTCATCGAGAGCGGGATGAAG TACGAGGACGCCATCCAGTTCATCCGACAGAAGCGCCGTGGGGCCATCAACAGCAAGCAGCTCACCTACC TGGAGAAGTACCGGCCTAAGCAGAGACTGAGGTTCAAAGACCCACACACGCACAAGACCAGATGCTGCGT CATGTAGCTCAGGCCCTGGCCCTGTACCTCATTACATCTGTGTCTAAGGAGTCCAACGGCTATGTGCGTC CCTGCTCTGTCCCCATCTGTACCCACGGCTGTCTTTCTGAAGCTGTCCCTGGACCCTCTGCCAGTCCTGT CCAACCCCTGTCCCTCACCCCCCACTGCCCAGGCCTTCCCCCTGGCCTGTGTATTGCAGGTGGGAGTTTT TAAACCACTGGGCCCAATGCCTCAGCGGCGTGGCCCTCACCCTAACCTTTTTCCAGCACCTTTGTTACCA GGTGCTCTGGACTCTCAAGGCAATAAATCAGGAGCTGTGAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_008975
Insert Size 522 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC027445, AAH27445
RefSeq Size 899 bp
RefSeq ORF 522 bp
Locus ID 19245
UniProt ID Q9D658
Cytogenetics 15 D3
Summary Protein tyrosine phosphatase which stimulates progression from G1 into S phase during mitosis. Enhances cell proliferation, cell motility and invasive activity, and promotes cancer metastasis. May be involved in the progression of cardiac hypertrophy by inhibiting intracellular calcium mobilization in response to angiotensin II.UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (2) has an alternate 5' UTR exon, as compared to variant 1. Variants 1, 2, 3 and 5 encode the same isoform 1.
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_008975" in other vectors (6)
SKU Description Size Price
MC207014 Ptp4a3 (untagged) - Mouse protein tyrosine phosphatase 4a3 (Ptp4a3), transcript variant 2, (10ug) 10 ug
$330.00
MG201490 Ptp4a3 (tGFP-tagged) - Mouse protein tyrosine phosphatase 4a3 (pPtp4a3) 10 ug
$500.00
MG225303 Ptp4a3 (tGFP-tagged) - Mouse protein tyrosine phosphatase 4a3 (Ptp4a3) transcript variant 2, (10ug) 10 ug
$500.00
MR225303 Ptp4a3 (Myc-DDK-tagged) - Mouse protein tyrosine phosphatase 4a3 (Ptp4a3), transcript variant 2 10 ug
$289.00 $300.00
MR225303L3 Lenti ORF clone of Ptp4a3 (Myc-DDK-tagged) - Mouse protein tyrosine phosphatase 4a3 (Ptp4a3), transcript variant 2 10 ug
$600.00
MR225303L4 Lenti ORF clone of Ptp4a3 (mGFP-tagged) - Mouse protein tyrosine phosphatase 4a3 (Ptp4a3), transcript variant 2 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products