OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Rab3a (NM_009001) Mouse Untagged Clone

Be the first to review this product
SKU
MC205452
Rab3a (untagged) - Mouse RAB3A, member RAS oncogene family (Rab3a), transcript variant 2, (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Rab3a or NM_009001"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Rab3a
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC053519
GCTAGGACTGCAGGGGCCTGAGCCTCCTCCGCTGCCGCCTGCAGCCCCCGCCGCCGCCTGCATCCCCCGC ATCCTCTTCTGGGGCCCGGTCGCCAGCGCAGTCGCCACGGTCGCCGTCGCCAGCGTTGTCTCAGCTTAGA GAGGGTAAGATGGCTTCCGCCACAGACTCTCGCTATGGGCAGAAGGAGTCCTCAGACCAGAACTTCGACT ATATGTTCAAGATCCTGATCATTGGGAACAGCAGCGTGGGCAAAACCTCGTTCCTCTTCCGCTACGCAGA TGACTCCTTCACTCCAGCCTTTGTCAGCACCGTTGGCATAGACTTCAAGGTCAAAACCATCTACCGCAAC GACAAGAGGATCAAGCTGCAGATCTGGGACACAGCAGGGCAAGAGCGGTACCGCACCATCACCACAGCCT ATTACCGAGGCGCCATGGGCTTCATCCTAATGTATGACATCACCAATGAGGAGTCATTTAATGCAGTGCA GGACTGGTCCACTCAGATCAAAACTTACTCGTGGGACAATGCCCAGGTGCTGCTGGTGGGAAACAAGTGT GACATGGAAGATGAGCGAGTGGTGTCCTCAGAGCGTGGCCGGCAGCTGGCTGACCACCTGGGCTTTGAGT TCTTTGAGGCCAGCGCCAAGGACAACATTAATGTCAAGCAGACGTTTGAACGTCTGGTGGACGTGATCTG TGAGAAGATGTCAGAGTCCCTGGATACTGCAGACCCTGCGGTCACCGGTGCCAAGCAGGGCCCGCAGCTC ACCGACCAGCAGGCGCCACCTCATCAGGATTGTGCCTGCTGAGCCACTTCCCTTCCCTGCTGCCAGGGGC ACGTCCCCCATCCCCGACTACCCTATTTATTATTGTAGCTATTTATTTATTTATTGAGGATGTGCCCCGA GCGCACCCCCTTCCCACCCTGTACATAGCTCCACCCAGCTCGGCCGTGGTGTATTGTGGTCACTGCTGCT CCCTCTCCTTTACCCCCCACCCCCATTTTGTTTTTGTAAACCATCCCGTCCACAGTTGTCAGTTGTGAAG AGGGGACCAGATGTCACTCTGCAGCAGGCTGATGGAAGATGGCGGGGCCTGCCAACCCCGAGGCTGGGGG ATCGCCATATGGACCACCTGGTTGACAGACGGCTTCTTGCTTGCCTGGGCCTTCTGCCTTATACTTTGGG ATAAATGGGGTGTAGGGGATATATTCACTACTTTGGGATACCCCCAAACCTGTTCTGACGTCGTGAGTGT CAAATGTGTCCCACTCCTCCCTAGAAGTTATGAACACTACACACAGTCAATAAAGCGAATGGACCTTGCT GAGTCTGCTGGCCCAGCCCCTGAACCCACCCACACGCAGTCCTTGACATTAAAGAGAATTTAATGAAAAA AAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_009001
Insert Size 663 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC053519, AAH53519
RefSeq Size 1410 bp
RefSeq ORF 663 bp
Locus ID 19339
UniProt ID P63011
Cytogenetics 8 34.15 cM
Summary Small GTP-binding protein that plays a central role in regulated exocytosis and secretion. Controls the recruitment, tethering and docking of secretory vesicles to the plasma membrane (PubMed:11598194). Upon stimulation, switches to its active GTP-bound form, cycles to vesicles and recruits effectors such as RIMS1, RIMS2, Rabphilin-3A/RPH3A, RPH3AL or SYTL4 to help the docking of vesicules onto the plasma membrane (By similarity). Upon GTP hydrolysis by GTPase-activating protein, dissociates from the vesicle membrane allowing the exocytosis to proceed (By similarity). Stimulates insulin secretion through interaction with RIMS2 isoform RIMS2 and RPH3AL effectors in pancreatic beta cells (PubMed:15159548, PubMed:20674857). Regulates calcium-dependent lysosome exocytosis and plasma membrane repair (PMR) via the interaction with 2 effectors, SYTL4 and myosin-9/MYH9 (By similarity). Acts as a positive regulator of acrosome content secretion in sperm cells by interacting with RIMS1 (By similarity). Plays a role in the regulation of dopamine release by interacting with synaptotagmin I/SYT (By similarity).UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (2) has an alternate splicing site in the 5' UTR, and is a shorter transcript, as compared to variant 1. Variants 1,2 and 3 encode the same protein.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_009001" in other vectors (4)
SKU Description Size Price
MG202514 Rab3a (tGFP-tagged) - Mouse RAB3A, member RAS oncogene family (Rab3a) 10 ug
$500.00
MR202514 Rab3a (Myc-DDK-tagged) - Mouse RAB3A, member RAS oncogene family (Rab3a), transcript variant 2 10 ug
$289.00 $300.00
MR202514L3 Lenti ORF clone of Rab3a (Myc-DDK-tagged) - Mouse RAB3A, member RAS oncogene family (Rab3a), transcript variant 2 10 ug
$600.00
MR202514L4 Lenti ORF clone of Rab3a (mGFP-tagged) - Mouse RAB3A, member RAS oncogene family (Rab3a), transcript variant 2 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products