OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

F2 (NM_010168) Mouse Untagged Clone

Be the first to review this product
SKU
MC205384
F2 (untagged) - Mouse coagulation factor II (F2), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $576.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "F2 or NM_010168"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol F2
Synonyms Cf-2; Cf2; F; FII; prot; thro
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC013662
AGCTGACACACTATGTCGCACGTCCGCGGCCTGGGCCTCCCTGGCTGCTTGGCTCTGGCTGCCCTGGTTA GCCTGGTACACAGCCAGCATGTGTTCCTGGCGCCTCAGCAAGCACTATCGCTGCTCCAGCGGGTCCGCAG AGCCAACAGTGGCTTCCTGGAGGAGCTCCGAAAGGGCAACCTAGAGCGTGAGTGCGTGGAAGAGCAGTGC AGCTATGAGGAGGCCTTTGAGGCCCTGGAGTCTCCCCAAGACACAGACGTGTTCTGGGCCAAGTACACAG TGTGTGATTCAGTGAGGAAACCTCGAGAGACTTTCATGGACTGTCTGGAAGGTCGCTGTGCTATGGATCT GGGTGTGAACTACCTTGGGACTGTGAATGTCACCCATACCGGTATCCAGTGCCAGCTGTGGCGGAGCCGC TACCCCCACAAGCCTGAAATCAACTCCACCACCCATCCTGGGGCAGACCTGAAGGAGAACTTCTGCCGCA ATCCAGACAGCAGTACCACGGGACCCTGGTGCTACACCACAGATCCTACTGTGCGCAGAGAGGAATGCAG TGTCCCTGTCTGTGGCCAGGAGGGCCGTACCACTGTGGTGATGACTCCTCGCTCTGGAGGTTCCAAGGAC AATCTGTCACCTCCACTGGGACAGTGCCTCACTGAGCGTGGCCGACTATACCAGGGGAATTTGGCTGTGA CAACACTTGGGTCCCCCTGCCTGCCCTGGAACAGCTTACCAGCCAAGACCCTGAGCAAGTACCAAGACTT CGACCCCGAGGTGAAACTCGTGGAAAACTTCTGCCGCAACCCAGACTGGGATGAGGAGGGCGCATGGTGC TATGTTGCGGGGCAGCCTGGCGACTTTGAATACTGCAACCTCAACTACTGCGAGGAGGCGGTGGGAGAGG AGAACTATGATGTGGACGAGTCCATCGCGGGACGCACCACCGATGCGGAGTTCCACACCTTCTTCAATGA GAAGACCTTCGGCCTTGGGGAGGCAGACTGTGGCCTGCGGCCTTTGTTCGAGAAGAAGTCGTTGAAAGAC ACAACCGAAAAGGAGCTTCTTGACTCTTACATAGACGGGCGCATCGTGGAGGGCTGGGACGCTGAGAAGG GTATCGCCCCCTGGCAGGTGATGCTTTTTCGGAAGAGTCCCCAAGAGCTGCTGTGTGGGGCCAGCCTTAT CAGTGACCGATGGGTCCTCACTGCTGCCCACTGCATTCTGTACCCACCCTGGGACAAGAACTTCACTGAG AATGACCTCCTGGTGCGCATTGGCAAGCATTCCCGAACCAGATATGAGCGGAATGTTGAAAAGATCTCCA TGCTGGAAAAGATCTACGTCCACCCCAGATATAACTGGCGGGAGAACCTAGACCGCGATATCGCTCTGCT CAAGCTAAAGAAACCTGTACCCTTCAGTGACTATATTCACCCCGTGTGTTTGCCAGACAAGCAGACAGTA ACCAGCTTGCTCCGGGCTGGTTATAAAGGGCGGGTGACAGGCTGGGGCAACCTTCGGGAGACATGGACAA CCAACATCAATGAGATACAGCCCAGCGTCCTGCAGGTGGTGAACCTGCCCATTGTAGAGCGGCCAGTGTG CAAGGCCTCCACCCGGATTCGAATTACTGACAACATGTTCTGTGCTGGCTTCAAGGTGAATGACACCAAG CGAGGAGATGCTTGTGAAGGTGACAGTGGAGGACCTTTTGTCATGAAGAGCCCCTTTAACAACCGCTGGT ATCAAATGGGTATTGTCTCATGGGGTGAAGGATGTGACCGGAAGGGGAAATACGGCTTCTACACGCATGT GTTCCGTCTGAAAAGGTGGATACAGAAAGTCATTGATCAATTTGGATAGGTGTGTGGGTGGGTAAAGGAC CTACACTATGGAATCCTCATTGCAAAATCACAGAAACCAATCAAATTACTTTTGTGGTTTGTTTCTGTTC TCAATAAAAGTGATTGTCAGTAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_010168
Insert Size 1857 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC013662, AAH13662
RefSeq Size 1998 bp
RefSeq ORF 1857 bp
Locus ID 14061
UniProt ID P19221
Cytogenetics 2 50.63 cM
Summary This gene encodes a vitamin K-dependent glycoprotein coagulation factor that plays an important role in the process of blood coagulation and hemostasis. The encoded protein is an inactive zymogen that undergoes enzymatic cleavage by the coagulation factor Xa to form an active serine protease that converts soluble fibrinogen to insoluble fibrin clot. Most of the mice lacking the encoded protein die at an embryonic stage due to defects in yolk sac vasculature, while the rare nenonates succumb to hemorrhage on the first postnatal day. provided by RefSeq, Apr 2015
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_010168" in other vectors (4)
SKU Description Size Price
MG209466 F2 (tGFP-tagged) - Mouse coagulation factor II (F2) 10 ug
$775.00
MR209466 F2 (Myc-DDK-tagged) - Mouse coagulation factor II (F2) 10 ug
$289.00 $575.00
MR209466L3 Lenti ORF clone of F2 (Myc-DDK-tagged) - Mouse coagulation factor II (F2) 10 ug
$875.00
MR209466L4 Lenti ORF clone of F2 (mGFP-tagged) - Mouse coagulation factor II (F2) 10 ug
$875.00

file-alt Citations

Targeting blood thrombogenicity precipitates atherothrombotic events in a mouse model of plaque destabilization
Liu, Ni, Ma et al
Sci Rep (2015) 5, 10225 DOI: 10.1038/srep10225
Cited by 18
AI Summary: OriGene's Ncaph2 cDNA (MC200537) was used to generate Ncaph2–eGFP fusion constructs for mRNA in vitro transcription experiments in this study.
Snippet: … Ncaph2 cDNA (Origene, MC200537) was cloned in fusion at the 5′ end of the eGFP ORF in the pRNA vector. All of the following cDNAs were cloned in the pRNA plasmid and linearized by the indicated enzymes: Ncaph2–eGFP (AscI), H2B–mCherry (AscI), securin–eGFP (AscI), tubulin–eGFP (AscI), TEV protease (AscI) and Mad2 (SfiI). …
FigureFigureFigure
Oroxylin A promotes PTEN-mediated negative regulation of MDM2 transcription via SIRT3-mediated deacetylation to stabilize p53 and inhibit glycolysis in wt-p53 cancer cells
Zhao, Zhou, Qiao et al
J Hematol Oncol (2015) 8 (1), 41 DOI: 10.1186/s13045-015-0137-1
Cited by 68
AI Summary: OriGene’s murine prothrombin cDNA clone (catalogue # MC205384) was used to construct a recombinant adenovirus for functional studies in this paper.
Snippet: Construction of a recombinant adenovirus expressing prothrombin A cDNA clone of murine prothrombin (purchased from OriGene, catalogue # MC205384) was subcloned into pAd/CMV/V5-Dest vector (Invitrogen, USA) (Ad-ProT) for adenovirus packaging in 293A cells. The adenovirus expressing EGFP alone (Ad-EGFP) was used as control
FigureFigureFigure
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products