OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Tcte3 (NM_011560) Mouse Untagged Clone

Be the first to review this product
SKU
MC204983
Tcte3 (untagged) - Mouse t-complex-associated testis expressed 3 (Tcte3), transcript variant 1, (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free DDK
AAV Particle:
DDK
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Tcte3 or NM_011560"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Tcte3
Synonyms D17Leh117c; LC2; Tcte-3; Tctex-2; Tctex-4; Tctex2; Tctex4
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC061136
AGGGCGGAGGGCGGAGGGCGGAGGCGTCCCGGTGAGCCGATCAAGATGGAGCGGCGAGGCCGAATGGCGA AGACGCCCACCGGCCAAACGCATCAATCCCCGGTGTCTAAGAGAGAAAGGAAGCCTAGCATGTTCGAGAA GGAGTCATATGCACAGATCTTAAGAGAAAGACTGAGAGAGTCTTTTCATGATGTTCAGTACGTGGAACCT CCGTTTGATGACTCAATTGCTGATGTAGGCAAAGAATGGAAAAGTGCCCTGGCAAAATTAAAGTTTGCTA ATTCATACAGAATGGAGCCACTGAAGAAATTTCAAGCACATTTGGTAGAAACTAAAATCCAGCAGATATT AAAGGACAGTCTTAAAGATGTCAAATATGATGACAAAGCCCCTCATTTGTCACTTGAATTGGCAGATCGA ATATTGGCAGCAGTCAAAGAATTTGCATACCATCGTTATAAATTCATTATACAAGTATTATTTATTCAAA AGACTGGTCAAGCAATAAATATTGCCAGCAGATGGATCTGGGATGTGGCATGGGACAACTGGGTAGAAGC TAAACATGAAACAGAGTCTTACGTGGTATTGGCCTTGGTGTTTGCTCTCTATTGTGAATAGCTCAGGACC AGCATTTTCACCCCCCATCCTTCAAAATAAATGATATATACAGAAAAAAAAAAAAAAAAGTAAAAAAAAA AAAAAAAAAAAAAAAAAAAAA
Restriction Sites SfiI-SfiI |
ACCN NM_011560
Insert Size 576 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC061136, AAH61136
RefSeq Size 721 bp
RefSeq ORF 576 bp
Locus ID 21647
UniProt ID P11985
Cytogenetics 17 8.95 cM
Summary This gene is one of three genes with a very high degree of similarity to each other within a 77 kb genomic span on Chromosome 17 A2. This gene is the most distal copy of the three genes. provided by RefSeq, Jul 2008
Transcript Variant: This variant (1) is the longer transcript and it encodes the longer protein (isoform 1).
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_011560" in other vectors (3)
SKU Description Size Price
MR201829 Tcte3 (Myc-DDK-tagged) - Mouse t-complex-associated testis expressed 3 (Tcte3), transcript variant 1 10 ug
$289.00 $300.00
MR201829L3 Lenti ORF clone of Tcte3 (Myc-DDK-tagged) - Mouse t-complex-associated testis expressed 3 (Tcte3), transcript variant 1 10 ug
$600.00
MR201829L4 Lenti ORF clone of Tcte3 (mGFP-tagged) - Mouse t-complex-associated testis expressed 3 (Tcte3), transcript variant 1 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products