OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Slc25a1 (NM_153150) Mouse Untagged Clone

Be the first to review this product
SKU
MC203218
Slc25a1 (untagged) - Mouse solute carrier family 25 (mitochondrial carrier, citrate transporter), member 1 (Slc25a1), nuclear gene encoding mitochondrial protein, (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
  $450.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Slc25a1 or NM_153150"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Slc25a1
Synonyms 1300019P08Rik; 2610100G11Rik; AI194714; Ctp; Dgsj; Slc20a3
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC037087
CCACGCGTCCGAGTAGCCTCCGGCTCCGCTGCTTCCCGAGAACCCCGCGCCGGAGGCTCGGACCCGAGGT CGACGCCGGGCGCCTCTCCTCCTGCCCGCTATGGCTGCGCCTCGCGGGCCCCGCGCTCTGTCGGCCGCCG CGCCGGGGTCCGGGAAGCCCAAACTGACGCACCCCGGGAAGGCAATCCTAGCAGGCGGCCTGGCTGGAGG CATCGAAATCTGCATCACCTTCCCGACCGAATACGTGAAGACGCAGCTGCAGCTAGATGAACGAGCGAAC CCACCGCGGTACCGGGGCATCGGAGACTGCGTGCGGCAAACTGTCCGCAGCCATGGCGTCCTGGGCCTGT ACCGCGGCCTCAGCTCCTTGCTCTACGGCTCCATCCCCAAGGCGGCTGTCAGGTTTGGGATGTTCGAGTT CCTCAGCAACCACATGCGGGATGCCCAAGGTAGGCTCGACAGCAGGAGAGGACTATTGTGCGGTCTGGGT GCCGGCGTGGCAGAAGCAGTGGTAGTCGTGTGCCCTATGGAGACCATCAAGGTGAAGTTCATCCATGACC AGACTTCCTCCAACCCCAAGTACCGAGGATTTTTCCACGGGGTTAGAGAGATTATTCGGGAACAAGGGCT AAAGGGAACATACCAAGGCCTTACTGCGACTGTACTGAAGCAGGGCTCAAACCAAGCCATCCGATTCTTT GTCATGACCTCCCTACGCAACTGGTACCAAGGAGACAACCACAACAAACCTATGAACCCACTGATCACGG GGGTCTTTGGAGCTACTGCGGGTGCAGCCAGTGTCTTTGGAAACACACCTTTGGATGTGATCAAGACCAG GATGCAGGGCCTGGAGGCACACAAATACCGGAACACCCTGGACTGCGGCTTGAAGATCCTAAAGAATGAG GGGCCAAAGGCATTCTACAAGGGCACCGTTCCCCGGCTGGGCCGAGTCTGCCTGGATGTGGCCATCGTAT TCATCATCTACGATGAAGTGGTGAAGCTGCTCAATAAAGTGTGGAAGACAGACTAACCCTGGAGGATGCA GTGGGGTATCCCAGCTCCTCCATTCCAGACCCCCCGCCACCTACTCTGATGATTCCAGTGCAGTAGTGCC AAAAGGCCCCTTCCTTTGTCCCTCAAGTTCTGTGGCCTGGTGTGTCCCATAGTTCTGTATATCCCATGTG GTCTGTGTGTGTGTAACACTACCATTGTATCTGTGTCCAGCCTGGCCATGGCTGGGTGTCTCTTTGGCCT GTGAATATGTGCTCACTTATCCATGTGCTTGCTTGTGAGCCACATGCCTGTTTCGTGTTCTCTGTCATGT GACCCTGTGCCCCACTTCCTGGGGTGCCTATGTGCCCTGGTTCATGGCCTTGGAGCCATGGTCAGGTCAC AGTCCGGTGCCTTCCACCCCCTATGGCAAGGGCGCCCTGCCTTGGCCTACCACAGCTGCCTCCAGGCTTA GACCTGGCTTCACCGCATTCCAGGGGCTATAGGCCCCCCTGCTTTTCCCGCCATTGGCCTTAAATGGCCC TCGGGCCCTCCCTCCGCCCGGAACAGGGTGGCACCTGCCACTCTCAGGACCACCTTGCCAAGGAGAATAA ACCGGATCCTGTTGCAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_153150
Insert Size 936 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC037087, AAH37087
RefSeq Size 1640 bp
RefSeq ORF 936 bp
Locus ID 13358
UniProt ID Q8JZU2
Cytogenetics 16 11.11 cM
Summary Citrate transporter that mediates the exchange of mitochondrial citrate for cytosolic malate. Also able to mediate the exchange of citrate for isocitrate, phosphoenolpyruvate, cis- but not trans-aconitate and to a lesser extend maleate and succinate. Important for the bioenergetics of hepatic cells as it provides a carbon source for fatty acid and sterol biosyntheses, and NAD(+) for the glycolytic pathway. Required for proper neuromuscular junction formation.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_153150" in other vectors (4)
SKU Description Size Price
MG204416 Slc25a1 (tGFP-tagged) - Mouse solute carrier family 25 (mitochondrial carrier, citrate transporter), member 1 (Slc25a1) 10 ug
$650.00
MR204416 Slc25a1 (Myc-DDK-tagged) - Mouse solute carrier family 25 (mitochondrial carrier, citrate transporter), member 1 (Slc25a1), nuclear gene encoding mitochondrial protein 10 ug
$450.00
MR204416L3 Lenti ORF clone of Slc25a1 (Myc-DDK-tagged) - Mouse solute carrier family 25 (mitochondrial carrier, citrate transporter), member 1 (Slc25a1), nuclear gene encoding mitochondrial protein 10 ug
$750.00
MR204416L4 Lenti ORF clone of Slc25a1 (mGFP-tagged) - Mouse solute carrier family 25 (mitochondrial carrier, citrate transporter), member 1 (Slc25a1), nuclear gene encoding mitochondrial protein 10 ug
$750.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products