OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Glrx3 (NM_023140) Mouse Untagged Clone

Be the first to review this product
SKU
MC203174
Glrx3 (untagged) - Mouse glutaredoxin 3 (Glrx3), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free DDK
  $457.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Glrx3 or NM_023140"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Glrx3
Synonyms PICOT; Txnl2
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC033506
GCGGAGACAGCATGGCGGCGGGGGCGGCCGAGGCAGGCGAGGCAGCCGTGGCAGTGGTGGAAGTCGGCTC TGCCCAGCAGTTTGAAGAGCTACTGCGCCTCAAAACCAAGTCACTCCTTGTGGTTCATTTCTGGGCACCA TGGGCTCCACAGTGTGTACAGATGAACGATGTCATGGCAGAGTTAGCTAAAGAACACCCTCATGTTTCAT TTGTGAAGCTGGAAGCCGAAGCTGTTCCTGAAGTATCTGAAAAATATGAAATTAGCTCTGTCCCCACCTT CCTGTTCTTCAAGAATTCTCAGAAAGTCGACCGGTTAGATGGTGCACATGCCCCAGAGTTGACCAAAAAA GTCCAGCGACACGTGTCTAGCGGAGCCTTTCCTCCTAGTACTAATGAACATCTTAAAGAAGACCTCAGCC TTCGCCTGAAAAAGCTGACTCACGCTGCCCCCTGCATGCTGTTCATGAAGGGAACACCTCAAGAACCGCG CTGTGGTTTCAGCAAGCAGATGGTGGAAATCCTTCACAAACACAATATTCAGTTCAGCAGCTTTGATATC TTCTCAGATGAAGAAGTTCGACAGGGGCTCAAAACGTACTCTAATTGGCCCACCTATCCTCAGCTCTATG TTTCTGGAGAGCTAATAGGAGGACTTGACATAATTAAGGAGCTGGAAGCATCAGAAGAGCTGGACACGAT CTGTCCCAAAGCACCCAAGTTAGAGGAAAGGCTCAAAGTGCTGACCAATAAAGCTTCCGTGATGCTCTTT ATGAAAGGAAACAAACAGGAAGCAAAATGTGGATTCAGCAAACAAATTCTGGAAATACTGAATAGTACTG GGGTTGAATATGAAACTTTTGATATACTGGAAGATGAAGAAGTGCGTCAGGGATTAAAAACGTTCTCAAA TTGGCCAACCTACCCTCAGCTGTATGTGAGAGGGGATCTTGTTGGAGGATTGGATATTGTCAAGGAACTG AAAGACAACGGTGAATTGCTGCCTATACTGAAAGGAGAAAATTAGTGAACATAAGCATGGTGTCCAAGGA CTGCAAGAAGTAACTAATTACCTTGGAACAGTTGATGATTTGGTCCTGAGAAGTGGACTAACAGTAGAGA TACAACACACTCAGCCATGCTCGATGCGCTTCAAAAGGTGTGCTGAAGAAACATGCTACGTTCTCCATGA AGCAGAGAAGGCAATAAACTCTTCAGACTCAGCTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_023140
Insert Size 1014 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC033506, AAH33506
RefSeq Size 1260 bp
RefSeq ORF 1014 bp
Locus ID 30926
UniProt ID Q9CQM9
Cytogenetics 7 F4
Summary Together with BOLA2, acts as a cytosolic iron-sulfur (Fe-S) cluster assembly factor that facilitates 2Fe-2S cluster insertion into a subset of cytosolic proteins (By similarity). Acts as a critical negative regulator of cardiac hypertrophy and a positive inotropic regulator (PubMed:16809552, PubMed:18258855, PubMed:18929570). Required for hemoglobin maturation. Does not possess any thyoredoxin activity since it lacks the conserved motif that is essential for catalytic activity (By similarity).UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (1) encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_023140" in other vectors (1)
SKU Description Size Price
MR205019 Glrx3 (Myc-DDK-tagged) - Mouse glutaredoxin 3 (Glrx3) 10 ug
$503.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products