OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Bcs1l (NM_025784) Mouse Untagged Clone

Be the first to review this product
SKU
MC202866
Bcs1l (untagged) - Mouse BCS1-like (yeast) (Bcs1l), nuclear gene encoding mitochondrial protein, (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $457.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Bcs1l or NM_025784"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Bcs1l
Synonyms 9130022O19Rik
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC019781 sequence for NM_025784
GTTCCTGGAAGCGCGAGCAGTTCTGCTACAATCCATCCCTCGGTTTTGACAGTGCCTCAGAGCCTATAAG CATCTGTGCTGCTTCTTTTCAAGATGCCATTTTCAGACTTTGTTCTGGCCCTTAAAGACAATCCCTACTT TGGGGCTGGATTTGGGCTGGTAGGTGTGGGTACGGCTCTGGCTATGGCCCGGAAAGGAGCCCAGTTGGGT CTAGTGGCATTCCGGCGCCATTACATGATCACACTGGAAGTCCCTGCCAGAGACAGAAGCTATGCCTGGT TGCTTAGCTGGCTTACCCGACACAGCACCCGCACTCAGCACCTCAGTGTTGAAACCTCATACCTTCAGCA TGAAAGTGGCCGGATCTCCACCAAGTTTGAATTTATCCCCAGCCCTGGAAACCACTTCATTTGGTATCAG GGAAAATGGATCCGGGTAGAACGAAACCGAGACATGCAGATGGTAGACTTGCAAACAGGGACTCCTTGGG AATCTGTCACCTTCACGGCCCTGGGCACTGACCGAAAGGTTTTCTTCAACATCCTGGAAGAAGCTCGAGC ACTGGCCCTGCAGCAGGAGGAAGGGAAGACTGTGATGTACACAGCTGTGGGGTCTGAATGGCGTACCTTT GGTTATCCGCGCCGACGTCGGCCACTGGATTCTGTAGTCCTACAGCAGGGTCTGGCTGACCGAATTGTCA AAGATATCCGGGAATTTATTGATAACCCCAAGTGGTACATTGACAGAGGCATTCCCTACAGACGTGGCTA CCTTCTTTATGGGCCCCCTGGTTGTGGAAAGAGCAGTTTTATAACAGCCCTGGCTGGAGAACTGGAACAC AGCATCTGCCTGCTCAGCCTCACAGACTCTAGCCTCTCAGATGACCGGCTCAACCATCTACTGAGTGTAG CACCACAGCAGAGCTTGGTGCTCCTGGAAGATGTGGATGCTGCTTTTCTCAGTAGAGACTTGGCTGTGGA GAACCCTATAAAGTACCAAGGACTAGGCCGCCTCACCTTCAGTGGACTGCTTAATGCTTTGGATGGTGTA GCCTCCACTGAAGCACGAATTGTGTTCATGACCACCAACTACATTGACAGGCTGGATCCTGCCCTCATAC GTCCCGGGCGAGTAGATCTGAAGGAGTATGTGGGCTACTGCTCACACTGGCAGCTGACCCAGATGTTCCA GAGGTTCTATCCAGGGCAAGCACCTTCTTTGGCTGAGAACTTTGCTGAACATGTCCTTAAAGCTACATCT GAGATTAGTCCTGCCCAGGTGCAAGGCTACTTCATGCTGTATAAAAATGACCCCATGGGGGCTGTTCACA ACATTGAATCTCTGAGGTGACCCACCAGGCCATGATCTGCTCTCAAAAATTCCATAAACACCTGTCACAC TAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_025784
Insert Size 1257 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC019781, AAH19781
RefSeq Size 1416 bp
RefSeq ORF 1257 bp
Locus ID 66821
UniProt ID Q9CZP5
Cytogenetics 1 C3
Summary The protein encoded by this gene is a chaperone protein that is involved in the assembly of complex III (CIII), one of the five protein complexes of the mitochondrial respiratory chain, and is necessary for the insertion of the Rieske iron-sulfur (RISP) and Qcr10p proteins into the precomplex. Studies from the yeast ortholog of this protein indicate that it is targeted to the inner membrane of the mitochondria, despite the absence of an N-terminal targeting sequence. Positively charged amino acids located C-terminal to the transmembrane domain are thought to act as an internal targeting signal (PMID:8599931). Mutations in the human ortholog of this gene have been associated with GRACILE syndrome, characterized by Growth retardation, Amino aciduria, Cholestasis, Iron overload, Lactic acidosis, and Early death. Mouse models with the corresponding mutation mimic the phenotype of GRACILE syndrome and display decreased complex III activity and decreased electron transport capacity (PMID:21274865). Alternative splicing results in multiple transcript variants. provided by RefSeq, Mar 2015
Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. Sequence Note:.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_025784" in other vectors (4)
SKU Description Size Price
MG206614 Bcs1l (tGFP-tagged) - Mouse BCS1-like (yeast) (Bcs1l) 10 ug
$657.00
MR206614 Bcs1l (Myc-DDK-tagged) - Mouse BCS1-like (yeast) (Bcs1l), nuclear gene encoding mitochondrial protein 10 ug
$289.00 $457.00
MR206614L3 Lenti ORF clone of Bcs1l (Myc-DDK-tagged) - Mouse BCS1-like (yeast) (Bcs1l), nuclear gene encoding mitochondrial protein 10 ug
$757.00
MR206614L4 Lenti ORF clone of Bcs1l (mGFP-tagged) - Mouse BCS1-like (yeast) (Bcs1l), nuclear gene encoding mitochondrial protein 10 ug
$757.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products