OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Myl12b (NM_023402) Mouse Untagged Clone

Be the first to review this product
SKU
MC201459
Myl12b (untagged) - Mouse myosin, light chain 12B, regulatory (Myl12b), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA348020 Rabbit Polyclonal Anti-MRLC2 Antibody
100 ug
$380.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Myl12b or NM_023402"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Myl12b
Synonyms 1500001M02Rik; C77744; Mylc2b; RLC-B
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC028878 sequence for NM_023402
CTCTCGGGTGTGCAGCATCAGGTCAGATTTAAACCGCCACCATGTCGAGCAAAAAAGCGAAGACCAAGAC CACCAAGAAGCGCCCTCAGCGCGCAACCTCCAATGTGTTCGCCATGTTTGACCAGTCCCAGATCCAGGAG TTCAAAGAGGCCTTTAACATGATTGACCAGAACCGGGATGGCTTCATTGACAAGGAGGACCTGCACGACA TGCTGGCGTCTCTGGGGAAGAATCCCACTGATGCCTACCTGGACGCCATGATGAACGAGGCCCCGGGCCC CATCAATTTCACCATGTTCCTCACCATGTTTGGGGAGAAGCTGAACGGCACTGACCCCGAGGACGTCATC AGAAACGCCTTCGCTTGCTTTGATGAGGAAGCCACAGGCACCATCCAGGAGGATTACCTGAGGGAGCTGC TGACCACCATGGGCGACCGCTTCACAGACGAGGAAGTGGATGAGCTGTACAGAGAGGCCCCCATTGACAA AAAGGGGAACTTCAACTACATTGAGTTCACACGCATCCTGAAGCACGGCGCGAAAGACAAAGATGACTGA AGAGCTGCGGCGGCTGACACGCCTCTTGCGTTTGCTTGCTCACTTCCTGTCTCAGACACACACACCCCAT AGGACCTACTGCGTGCCACTTAGTTTCTCAGTCACTTCCCCTCCCCCATAGGGCCTACTGTGTGCCACTT AGTTGAGAGCTTTTTTTTTAAATGTATTTATTCCAGGCCCTTTCTGTCACTTAGCATGTGCATAATCAGA CTGGAACGGGGGACAATGTTGTAAATTGTACTGAAAACGAGATGCAAATAAAAAATGAACCACTGTGAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_023402
Insert Size 519 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC028878, AAH28878
RefSeq Size 896 bp
RefSeq ORF 519 bp
Locus ID 67938
UniProt ID Q3THE2
Cytogenetics 17 E1.3
Summary Myosin regulatory subunit that plays an important role in regulation of both smooth muscle and nonmuscle cell contractile activity via its phosphorylation. Phosphorylation triggers actin polymerization in vascular smooth muscle. Implicated in cytokinesis, receptor capping, and cell locomotion.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_023402" in other vectors (4)
SKU Description Size Price
MG201457 Myl12b (tGFP-tagged) - Mouse myosin light chain, regulatory B (Mylc2b) 10 ug
$500.00
MR201457 Myl12b (Myc-DDK-tagged) - Mouse myosin, light chain 12B, regulatory (Myl12b) 10 ug
$289.00 $300.00
MR201457L3 Lenti ORF clone of Myl12b (Myc-DDK-tagged) - Mouse myosin, light chain 12B, regulatory (Myl12b) 10 ug
$600.00
MR201457L4 Lenti ORF clone of Myl12b (mGFP-tagged) - Mouse myosin, light chain 12B, regulatory (Myl12b) 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products