Sprr2a1 (NM_011468) Mouse Untagged Clone

SKU
MC201169
Sprr2a1 (untagged) - Mouse small proline-rich protein 2A1 (Sprr2a1), (10ug)
  $150.00
In Stock*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Sprr2a1
Synonyms Sprr2a; Sprr2a3
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC010818 sequence for NM_011468
CAAGCATTGGTCTGCTCCGGAGAACCTGATTCTGAGACTCAAGTACGATGTCTTACTACCAGCAGCAGTG CAATCAGCCGTGCCGGCCTCCTCCTGTGTGCCCACCCCCGAAGTGCCCTGAGCCTTGTCCTCCCCAAGTG TGGCCTGGGCCTTGTCGTCCTGTCATGTGCTTTGAGCCTTGTCTTCCTTCAGTGTGGCCTGGGCCGTGTC GTCCTGTAGTGTGCTATGAGCAATGCCCACCTCAGCCATGGCAGTCAACATGCCCTCCTGTGCAATTTCC ACCATGCCAGCAGAAGTGACCACCCAACAGGTGAAGGCCTCCCAGTCATCAGGACCAGGGGAAGTGAAAG AAATCTGTCTCACCAGCTCACCGACTCCATAGCAACACTTCCATCCTCCTTTGAAAGCCTGTCTGGATGC AGAAGAATCTTCTCCACCCTTCATCCTCCATGTGCTTATGATGGCTCCTCACAGAGAAGGCATTGCTCTC AGGCTGATCTCCTGCTGCTTTCCTGGGGATGCTGAGAATGATCCTTTCTCTTGTTTTTGTACACCAGGGG AAGCACAACAGGTATCTACTCTGTGCTTTCAGAGGAGCCTTCTCAGCCTGCCTGTTACCTGATCAGGGCA ATGGTCACTGCTGTTTCATTTCCTGAAATAAAAAAGGACCCCTTTGGTGATGGTCTAATAAATACTTTTT TTCTTGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_011468
Insert Size 252 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC010818, AAH10818
RefSeq Size 738 bp
RefSeq ORF 252 bp
Locus ID 20755
UniProt ID Q4KL71
Cytogenetics 3 40.14 cM
Summary Cross-linked envelope protein of keratinocytes. It is a keratinocyte protein that first appears in the cell cytosol, but ultimately becomes cross-linked to membrane proteins by transglutaminase. All that results in the formation of an insoluble envelope beneath the plasma membrane (By similarity).UniProtKB/Swiss-Prot Function
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources
"NM_011468" in other vectors (5)
SKU Description Size Price
MG200162 Sprr2a1 (tGFP-tagged) - Mouse small proline-rich protein 2A (Sprr2a) 10 ug
$350.00
MG215331 Sprr2a1 (tGFP-tagged) - Mouse small proline-rich protein 2A1 (Sprr2a1), (10ug) 10 ug
$350.00
MR215331 Sprr2a1 (Myc-DDK-tagged) - Mouse small proline-rich protein 2A1 (Sprr2a1) 10 ug
$289.00
MR215331L3 Lenti ORF clone of Sprr2a1 (Myc-DDK-tagged) - Mouse small proline-rich protein 2A1 (Sprr2a1) 10 ug
$450.00
MR215331L4 Lenti ORF clone of Sprr2a1 (mGFP-tagged) - Mouse small proline-rich protein 2A1 (Sprr2a1) 10 ug
$450.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products