OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Atp5g1 (NM_007506) Mouse Untagged Clone

Be the first to review this product
SKU
MC200524
Atp5g1 (untagged) - Mouse ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c1 (subunit 9) (Atp5g1), nuclear gene encoding mitochondrial protein, transcript variant 1, (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Atp5g1 or NM_007506"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Atp5g1
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC003854 sequence for NM_007506
GGAGTGTGCTGTGGGCCGAGCAGGGGCTGCAGGGGAGTGGGAGTGCAGATTGAAAAATGCAGACCACCAA GGCACTGCTCATTTCTCCAGCTCTGATTCGCTCCTGTACCAGGGGTCTAATCAGGCCTGTGTCTGCCTCC CTCCTGAGCAGACCAGAGGCCCCATCTAAGCAGCCTTCCTGCAGCAGCTCCCCTCTCCAGGTGGCCCGAC GGGAATTCCAGACCAGTGTCATTTCCCGGGACATCGACACAGCAGCCAAGTTCATTGGTGCTGGGGCCGC CACAGTTGGTGTGGCTGGATCAGGAGCTGGCATTGGCACAGTGTTTGGTAGCTTGATTATTGGCTATGCC AGGAACCCATCTCTCAAGCAGCAGCTCTTCTCCTATGCCATTCTGGGGTTTGCCCTGTCTGAGGCCATGG GACTCTTCTGTTTGATGGTCGCCTTCCTCATCCTCTTCGCCATGTGAGGCTCCCTGGGGTCACCCAGCCG TCCCTGCTGCTTTGACTCCATGCCAGTCCTGGTGCTGGAGTCTACTGAGCTTTACCATTAAACAACAACA ACAACAACAACAACGTTTCTCTAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_007506
Insert Size 411 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC003854, AAH03854
RefSeq Size 599 bp
RefSeq ORF 411 bp
Locus ID 11951
UniProt ID Q9CR84
Cytogenetics 11 D
Summary Mitochondrial membrane ATP synthase (F(1)F(0) ATP synthase or Complex V) produces ATP from ADP in the presence of a proton gradient across the membrane which is generated by electron transport complexes of the respiratory chain. F-type ATPases consist of two structural domains, F(1) - containing the extramembraneous catalytic core and F(0) - containing the membrane proton channel, linked together by a central stalk and a peripheral stalk. During catalysis, ATP synthesis in the catalytic domain of F(1) is coupled via a rotary mechanism of the central stalk subunits to proton translocation. Part of the complex F(0) domain. A homomeric c-ring of probably 10 subunits is part of the complex rotary element (By similarity).UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (1) and variant 2 encode the same protein.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_007506" in other vectors (4)
SKU Description Size Price
MG200836 Atp5g1 (tGFP-tagged) - Mouse ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 1 (Atp5g1) 10 ug
$350.00
MR200836 Atp5g1 (Myc-DDK-tagged) - Mouse ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c1 (subunit 9) (Atp5g1), nuclear gene encoding mitochondrial protein, transcript variant 1 10 ug
$289.00
MR200836L3 Lenti ORF clone of Atp5g1 (Myc-DDK-tagged) - Mouse ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c1 (subunit 9) (Atp5g1), nuclear gene encoding mitochondrial protein, transcript variant 1 10 ug
$450.00
MR200836L4 Lenti ORF clone of Atp5g1 (mGFP-tagged) - Mouse ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c1 (subunit 9) (Atp5g1), nuclear gene encoding mitochondrial protein, transcript variant 1 10 ug
$450.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products