Derl1 (NM_024207) Mouse Untagged Clone

SKU
MC200453
Derl1 (untagged) - Mouse Der1-like domain family, member 1 (Derl1), (10ug)
  $300.00
In Stock*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Derl1
Synonyms 1110021N07Rik; AI195141; AW551338; Derlin-1
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC003454 sequence for NM_024207
GTCCGAATTCGGTGGCGCCACGTCCGTCGGTCTCCGCCTCCTGCACAGCGGCTGCGCCTCCACTTTCCCT GGCCAAGCCGGCCGCGGAGCGCGGGGTGGGCACGGGAGGACGCGCGGCGCTGCGCAGCCGGTCACCTGAC GGGCGACCATGTCGGACATCGGGGACTGGTTCAGGAGCATCCCGGCCATCACGCGCTACTGGTTTGCTGC CACCGTTGCTGTCCCCTTGATCGGCAAGCTCGGCATCATCAGCCCGGCCTACTTCTTCCTCTGGCCCGAA GCCTTCCTCTATCGCTTCCAGATATGGAGGCCGTTCACTGCCACCTTTTACTTCCCCGTGGGCCCAGGGA CTGGATTTCTGTATTTGGTCAATTTATATTTCTTATATCAGTATTCTACTCGGCTTGAAGCAGGAGCTTT TGACGGGAGGCCAGCAGACTATTTATTCATGCTTCTCTTTAACTGGATCTGCATCGTTATTACTGGCTTA GCAATGGATATGCAGCTGCTGATGATCCCTCTGATCATGTCAGTGCTCTACGTCTGGGCCCAGCTGAACA GAGACCTGATCGTGTCGTTCTGGTTCGGAACGCGATTTAAGGCCTGTTACTTACCTTGGGTTATCCTTGG ATTCAACTATATCATTGGAGGCTCGGTGATCAATGAGCTCATTGGAAACCTTGTCGGCCATCTTTATTTC TTCCTGATGTTCAGATACCCAATGGACTTGGGAGGAAGGAATTTTCTGTCCACACCTCAGTTTTTGTACC GCTGGCTACCCAGTAGGAGAGGAGGGGTGTCAGGATTTGGTGTGCCCCCTGCTAGCATGAGGCGAGCTGC TGATCAGAATGGCGGAGGCGGGAGACACAACTGGGGCCAGGGCTTCCGACTTGGAGACCAGTGAGGGGCA GCCCTGGCCTGCTCACCAGCCATGCCGAGCAGATGACAGTCTCCTCCCAGTGCTGGGCATGCTTAGTGGC CGAGCTCTTGCTGCCGCTCTTGGACCTGACCCACACTGAATGTAGTCTTTCAGTACAAGACACATTTTTA AGTCCTCAAGGAAAATACAAGTGTTCCTCAAGTTTCATGATTCTCATTCAAGTCCTTACTGCTATGAAGA ACAAATATCAGCTGTGCAGATTTCAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_024207
Insert Size 756 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC003454, AAH03454
RefSeq Size 1166 bp
RefSeq ORF 756 bp
Locus ID 67819
UniProt ID Q99J56
Cytogenetics 15 D1
Summary Functional component of endoplasmic reticulum-associated degradation (ERAD) for misfolded lumenal proteins. May act by forming a channel that allows the retrotranslocation of misfolded proteins into the cytosol where they are ubiquitinated and degraded by the proteasome. May mediate the interaction between VCP and the misfolded protein. Also involved in endoplasmic reticulum stress-induced pre-emptive quality control, a mechanism that selectively attenuates the translocation of newly synthesized proteins into the endoplasmic reticulum and reroutes them to the cytosol for proteasomal degradation. By controlling the steady-state expression of the IGF1R receptor, indirectly regulates the insulin-like growth factor receptor signaling pathway.UniProtKB/Swiss-Prot Function
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_024207" in other vectors (4)
SKU Description Size Price
MG203204 Derl1 (tGFP-tagged) - Mouse Der1-like domain family, member 1 (Derl1) 10 ug
$500.00
MR203204 Derl1 (Myc-DDK-tagged) - Mouse Der1-like domain family, member 1 (Derl1) 10 ug
$289.00 $300.00
MR203204L3 Lenti ORF clone of Derl1 (Myc-DDK-tagged) - Mouse Der1-like domain family, member 1 (Derl1) 10 ug
$600.00
MR203204L4 Lenti ORF clone of Derl1 (mGFP-tagged) - Mouse Der1-like domain family, member 1 (Derl1) 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products