Surf1 (NM_013677) Mouse Untagged Clone

SKU
MC200124
Surf1 (untagged) - Mouse surfeit gene 1 (Surf1), (10ug)
  $300.00
In Stock*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Surf1
Synonyms 0610010F23Rik; Surf-1
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC004755 sequence for NM_013677
CTCTTCCGGTCACGGTTCTCTTCCGACCTTGCGGGTGTTGGGCAGTAGTCTCAAGCTGGGGTGCTGGCGC AAGAATGCAAGCACATCAGAGGGTGGTTCGTCCATGATCGGAGATGCCCATCTGACGCCGCAGCCACCAC GTGAGACAGAGCGCCGTCCCGGAAGGAAGCAGATTTCTCGGTCCCGGAAGTGCTCAAAGATGGCTGCTGT GATGGCTTTGGCTGTGCTGCCGCGACGGATGACGCGGTGGTCGCAATGGGCCTACGCGGGACGGGCCCAG TTCTGCGCTGTCAGGAGGAGCGTCTTTGGGTTTTCTGTCCGCTCAGGGATGGTCTGTAGGCCACGCAGGT GTTGCAGTTCTACTGCTGAAACAGCCGCCGCTAAAGCAGAGGACGATTCTTTTCTCCAGTGGTTCCTGCT TTTAATCCCTGCTACTGCTTTTGGCCTGGGGACTTGGCAGGTCCAACGTCGGAAATGGAAGCTGAAACTT ATTGCAGAATTAGAGTCTCGAGTCATGGCTGAGCCCATCCCTCTACCAGCAGACCCAATGGAACTGAAAA ATTTGGAGTACAGGCCAGTGAAGGTCAGGGGCCACTTTGACCACTCTAAAGAGTTGTACATAATGCCTCG GACCATGGTGGATCCTGTCCGAGAGGCGCGAGATGCTGGCAGACTATCCTCAACTGAAAGTGGGGCCCAT GTAGTTACTCCTTTCCATTGCTCTGACTTGGGAGTCACCATCCTGGTTAATAGAGGGTTTGTTCCCAGGA AGAAAGTGAATCCTGAGACCAGACAGAAAGGCCAGGTTCTGGGAGAAGTAGACCTAGTTGGCATAGTGAG GCTCACAGAAAACAGGAAGCCCTTTGTTCCGGAGAACAGCCCAGAAAGGAATCACTGGTATTATCGAGAC CTGGAAGCTATGGCCAAGATAACAGGAGCGGACCCCATTTTCATTGATGCAGACTTCCACAGCACAGCCC CCGGCGGGCCCATCGGAGGACAGACGAGAGTGACTCTGCGCAATGAGCACATGCAGTACATCCTTACCTG GTACGGACTGTGTGCGGCCACATCATATTTGTGGTTCCAAAAATTTGTACGTCGGACACCCATCATGTGA AGTAAGGAGCCTGTTCCCAACAACCATAAAATAAAGATCTTGCTATGTAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_013677
Insert Size 921 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC004755, AAH04755
RefSeq Size 1184 bp
RefSeq ORF 921 bp
Locus ID 20930
UniProt ID P09925
Cytogenetics 2 19.1 cM
Summary Component of the MITRAC (mitochondrial translation regulation assembly intermediate of cytochrome c oxidase complex) complex, that regulates cytochrome c oxidase assembly.UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (1) encodes the longer isoform (1). An in-frame AUG is located 32 codons upstream of the annotated translation start site but is not being annotated as a start site since it is not conserved and is in a weak Kozak sequence context. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The extent of this transcript is supported by transcript alignments.
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_013677" in other vectors (4)
SKU Description Size Price
MG204341 Surf1 (tGFP-tagged) - Mouse surfeit gene 1 (Surf1) 10 ug
$500.00
MR204341 Surf1 (Myc-DDK-tagged) - Mouse surfeit gene 1 (Surf1) 10 ug
$289.00 $300.00
MR204341L3 Lenti ORF clone of Surf1 (Myc-DDK-tagged) - Mouse surfeit gene 1 (Surf1) 10 ug
$600.00
MR204341L4 Lenti ORF clone of Surf1 (mGFP-tagged) - Mouse surfeit gene 1 (Surf1) 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products