OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Tsen34 (NM_024168) Mouse Untagged Clone

Be the first to review this product
SKU
MC200078
Tsen34 (untagged) - Mouse tRNA splicing endonuclease 34 homolog (S. cerevisiae) (Tsen34), transcript variant 2, (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free DDK
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Tsen34 or NM_024168"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Tsen34
Synonyms 0610027F08Rik; Leng5
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC002205 sequence for NM_024168
CCCACGCGTCCGCCGCGACGCACCCCCACTCCGCAGGAAGATGCTGGTGGTGGAGGTCGCAAATGGCCGC TCGCTGGTGTGGGGAGCCGAGGCCGTGCAGGCGCTGCGGGAGCGTCTGGGAGTCGGGGGACGCACGGTGG GCGCCCTGCCCCGCGGGCCCCGCCAGAACTCGCGCCTGGGCCTTCCACTTCTGCTGCTGCCTGAAGAAGC CCGGCTCCTGGCCGAGATAGGCGCGGTGACCCTAGTCAGCGCCCCGCGCCCGGACCCCCGCAACCATGGC TTGGCCCTAGCATCGTTCAAACGCCAGCAAGAGCAGAGTTTCCAGGATCAGAACACTTTGGCAGCCGAGG CCCGGGAGACCCGGCGTCAGGAGCTTCTAGAGAAGATCGTAGAGGGCCAGGCTGCCAAGAAGCAGAAGCT GGAACAGGATTCAGGGGCAGATGAAGGAGGCCAAGAAGCCGGTGGAAGTGAGGCTACCCAAGGGAGTGAG ACCAGTGATGATGGCCAGCCTTCTGCGGAGCAGGAGGGAGCAGCCCCATCCCTAGATTCTTCATCTCCCC AACCAGGACCTTCAAATGGGGTGACTCCCTTGCCCAGATCAGCCCTGCTTATCCAGCTGGCCACTGCCAG GCCTCGGCCTGTAAAAGCTAAGCCTCTGGACTGGCGTGTGCAGTCCAAAGACTGGCCCCATGCTGGCCGT CCTGCCCACGAGCTGCGCTACAGCATCTACCGAGACCTGTGGGAGAGAGGTTTCTTCCTCAGCGCAGCAG GGAAGTTTGGTGGTGACTTCCTGGTCTATCCTGGTGATCCACTGCGTTTCCATGCTCACTACATTGCTCA GTGCTGGTCTGCTGAGGACCCCATCCCACTTCAGGACCTGGTCTCTGCAGGCCGCCTGGGAACCAGTGTC AGGAAGACCCTGCTGCTCTGCTCCCCTCAGCCTGATGGGAAGGTGGTCTACACATCCCTGCAGTGGGCCA GCCTGCAGTGAGCTGGAGACTGTGTGTGGCAAGAACCCTCTTCAATGGTCGCCCCAGCTCATCTCTGCAC GGAGGCTTGCACTCTCCTGCTCTGCCTGGTTTGTTCCGATTCCAGGGTTTTGAACACTACATCCTTTCTG TTTGTTTTTTGGTTTTGTTTTTCCTGTTTTAAGGCGATTACTACCTGTGTTGTTCTTTATTTTGTTTCCA AATTGTGCTTGTTGAGCATGGAGACTGCTTTTGTTTGGCTTTTGTGTTTCTTGCGGGGCTTAGGTTCCTG CAGTTCTCAATAAATTTGTTGAATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_024168
Insert Size 951 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC002205, AAH02205
RefSeq Size 1320 bp
RefSeq ORF 951 bp
Locus ID 66078
UniProt ID Q8BMZ5
Cytogenetics 7 A1
Summary Constitutes one of the two catalytic subunit of the tRNA-splicing endonuclease complex, a complex responsible for identification and cleavage of the splice sites in pre-tRNA. It cleaves pre-tRNA at the 5'- and 3'-splice sites to release the intron. The products are an intron and two tRNA half-molecules bearing 2',3'-cyclic phosphate and 5'-OH termini. There are no conserved sequences at the splice sites, but the intron is invariably located at the same site in the gene, placing the splice sites an invariant distance from the constant structural features of the tRNA body. The tRNA splicing endonuclease is also involved in mRNA processing via its association with pre-mRNA 3'-end processing factors, establishing a link between pre-tRNA splicing and pre-mRNA 3'-end formation, suggesting that the endonuclease subunits function in multiple RNA-processing events (By similarity).UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (2) represents of an alternate promoter and 5' UTR, compared to variant 1, and encodes the longer isoform (a). Both variants 1 and 2 encode the same isoform (a).
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_024168" in other vectors (3)
SKU Description Size Price
MR204523 Tsen34 (Myc-DDK-tagged) - Mouse tRNA splicing endonuclease 34 homolog (S. cerevisiae) (Tsen34), transcript variant 2 10 ug
$330.00
MR204523L3 Lenti ORF clone of Tsen34 (Myc-DDK-tagged) - Mouse tRNA splicing endonuclease 34 homolog (S. cerevisiae) (Tsen34), transcript variant 2 10 ug
$630.00
MR204523L4 Lenti ORF clone of Tsen34 (mGFP-tagged) - Mouse tRNA splicing endonuclease 34 homolog (S. cerevisiae) (Tsen34), transcript variant 2 10 ug
$630.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products