OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Elp5 (NM_018740) Mouse Untagged Clone

Be the first to review this product
SKU
MC200067
Elp5 (untagged) - Mouse retinoic acid induced 12 (Rai12), transcript variant 1, (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Elp5 or NM_018740"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Elp5
Synonyms Derp6; Rai12
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC003752 sequence for NM_018740
GTCTCTAGGACTGTGTACAGAGACTCTGGAGCGGCCCCTCCGTGTAAGCCCCCTGAGAATACGGAGCATA AAAAAACCAGGCTCCTCTTTCCGGACTTTGCGGTCCTTTAAGGTTGGAAGCAATCGTAAGTGCCCCGCCT CCTCGGTGGTGACGACATCAGAAGGCGTCCTGAGGCGTCAGAGATGCTGGACTCGTTGTTGGCCATCGGT GGTTTGGTGCTTTTGCGAGATTCCGTGGAGTGGGAAGGGCGTAGTCTCCTGAAGGCTCTTATCAAGAAAT CTGCACTTCGTGGGGAGCAGGTCCACGTTCTGGGCTGTGAAGTGAGCGAAGAAGAGTTTCGCGAAGGTTT CGACTCTGATGTCAACAGCCGCCTGGTTTACCATGACCTCTTCAGAGACCCTCTTAACTGGTCAAAGCCT GGAGAAGCTGTCCCTGAAGGTCCTCTAAAAGCCTTGAGGTCCATGTGCAAAAGGACAGACCATGGCTCAG TCACCATTGCCCTTGACTCTCTCAGCTGGCTGCTGTGTCACATTCCCTGTGTTACACTCTGTCAAGCCCT ACATGCTCTGAGCCAGCAAAATGGAGACCCAGGTGATAACTCCCTAGTAGAGCAGGTGCGTGTCCTGGGC CTCCTACATGAAGAGCTTCATGGCCCAGGCTCCATGGGAGCACTGAACACCCTTGCTCACACAGAGGTGA CTCTGAGTGGTAAAGTGGACCAGACCTCAGCCTCCATCCTCTGTCGAAGGCCCCAACAACGTGCAACTTA CCAGACTTGGTGGTTCTCCGTTCTTCCTGACTTCAGCCTGACTCTCCATGAAGGGCTTCCCCTCCGTTCT GAGCTACACCCGGATCATCACACAACCCAGGTGGATCCCACTGCTCATTTGACCTTTAACCTTCACTTAT CCAAGAAAGAAAGAGAAGCCAGAGACAGCCTCACTCTGCCTTTCCAGTTCAGCTCTGAAAAACAGAAAGC TCTGCTGCATCCGGTACCCAGCCGGACCACTGGCCACATCTTCTATGAGCCAGATGCTTTTGATGATGTG GACCCAGAAGACCCAGATGATGACCTAGATATTTGACAGACAAATGGCAGAGGAAGGCTGTGGGCTCAGA ACCACCCTGCTGTTGGCAGACTCTACCTTGTCCCTTGTCCTTTGTTACTTTGTCTGCAGAAGCTGTGTCG TGAGCCAAGGAGCAGCATCAAGCTAGGATGAGTGTGATGAGGGCATAGTGTGTGCCCATTTCTAATAAAA TATATATGTGTGTGTGTGTCAATCAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_018740
Insert Size 903 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC003752, AAH03752
RefSeq Size 1306 bp
RefSeq ORF 903 bp
Locus ID 54351
UniProt ID Q99L85
Cytogenetics 11 B3
Summary Acts as subunit of the RNA polymerase II elongator complex, which is a histone acetyltransferase component of the RNA polymerase II (Pol II) holoenzyme and is involved in transcriptional elongation. Elongator may play a role in chromatin remodeling and is involved in acetylation of histones H3 and probably H4. May be involved in TP53-mediated transcriptional regulation. Involved in cell migration.UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_018740" in other vectors (4)
SKU Description Size Price
MG204184 Elp5 (tGFP-tagged) - Mouse retinoic acid induced 12 (Rai12) 10 ug
$500.00
MR204184 Elp5 (Myc-DDK-tagged) - Mouse retinoic acid induced 12 (Rai12), transcript variant 1 10 ug
$289.00 $300.00
MR204184L3 Lenti ORF clone of Elp5 (Myc-DDK-tagged) - Mouse retinoic acid induced 12 (Rai12), transcript variant 1 10 ug
$600.00
MR204184L4 Lenti ORF clone of Elp5 (mGFP-tagged) - Mouse retinoic acid induced 12 (Rai12), transcript variant 1 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products