OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

TJP1 (NM_003257) Human 3' UTR Clone

Be the first to review this product
SKU
SC214630
3' UTR clone of tight junction protein 1 (zona occludens 1) (TJP1) transcript variant 1 for miRNA target validation
  $683.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PR300001 Firefly luciferase assay kit, 150 assays
1 kit
$235.00

Other products for "TJP1 or NM_003257"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol TJP1
Synonyms ZO-1
ACCN NM_003257
Insert Size 1477 bp
Sequence Data
Insert Sequence
>SC214630 3' UTR clone of NM_003257
The sequence shown below is from the reference sequence of NM_003257. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TCTCGTTGGAGCAAACTGTGTTTCTGTCCTTATTGACCACTTTTAACTCTTGAAATATAGGAACTTAAAT
AATGTGAAACTGGATTAAACTTAATCTAAATGGAACCACTCTATCAAGTATTATACCTTTTTTAGAGTTG
ATACTACAGTTTGTTAGTATGAGGCATTTGTTTGAACTGATAAAGATGAGTGAGCATGCCCCTGAACCAT
GGTCGGAAAACATGCTACACACTGCATGTTTGTGATTGACGGGACTGTTGGTATTGGCTAGAGGTTCAAA
GATATTTTGCTTTGTGATTTTTGTAATTTTTTTATCGTCACTGCTTAACTTCACATATTGATTTCCGTTA
AAATACCAGCCAGTAAATGGGGGTGCATTTGAGGTCTGTTCTTTCCAAAGTACACTGTTTCAAACTTTAC
TATGGCCCTGGCCTAGCATACGTACACATTTTATTTTATTATGCATGAAGTAATATGCACACATTTTTTA
AATGCACCTGGAATATATAACCAGTGTTGTGGATTTAACAGAAATGTACAGCAAGGAGATTTACAACTGG
GGGAGGGTGAAGTGAAGACAATGACTTACTGTACATGAAAACACATTTTTCTTAGGGAAGGATACAAAAG
CATGTGAGACTGGTTCCATGGCCTCTTCAGATCTCTAACTTCACCATATTACCACAGACATACTAACCAG
CAGAAATGCCTTACCCTCATGTTCTTAATTCTTAGCTCATTCTCCTTGTGTTACTAAGTTTTTATGGCTT
TTGTGCATTATCTAGATACTGTATCATGACAAAGACTGAGTACGTTGTGCATTTGGTGGTTTCAGAAATG
TGTTATCACCCAGAAGAAAATAGTGGTGTGATTTGGGGATATTTTTTTCTTTTCTTTTCTTTTCTTTTTT
TTTTTTTTTGACAAGGGGCAGTGGTGGTTTTCTGTTCTTTCTGGCTATGCATTTGAAAATTTTGATGTTT
TAAGGATGCTTGTACATAATGCGTGCATACCACTTTTGTTCTTGGTTTGTAAATTAACTTTTATAAACTT
TACCTTTTTTATACATAAACAAGACCACGTTTCTAAAGGCTACCTTTGTATTCTCTCCTGTACCTCTTGA
GCCTTGAACTTTGACCTCTGCAGCAATAAAGCAGCGTTTCTATGACACATGCAAGGTCATTTTTTTTAAG
AAAAAGGATGCACAGAGTTGTTACATTTTTAAGTGCTGCATTTAAAAGATACAGTTACTCAGAATTCTCT
AGTTTGATTAAATTCTTGCAAAGTATCCCTACTGTAATTTGTGATACAATGCTGTGCCCTAAAGTGTATT
TTTTTACTAATAGACAATTTATTATGGCACATCAGCACGATTTCTGTTTAGATAATACACCACTACATTC
TGTTAATCATTAGGTGTGACTGAATTTCTTTTGCCGTTATTAAAAATCTCAAATTTCTAAATCTCCAAAA
TAAAACT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_003257.3
Locus ID 7082
Summary This gene encodes a member of the membrane-associated guanylate kinase (MAGUK) family of proteins, and acts as a tight junction adaptor protein that also regulates adherens junctions. Tight junctions regulate the movement of ions and macromolecules between endothelial and epithelial cells. The multidomain structure of this scaffold protein, including a postsynaptic density 95/disc-large/zona occludens (PDZ) domain, a Src homology (SH3) domain, a guanylate kinase (GuK) domain and unique (U) motifs all help to co-ordinate binding of transmembrane proteins, cytosolic proteins, and F-actin, which are required for tight junction function. Alternative splicing results in multiple transcript variants encoding different isoforms. provided by RefSeq, Aug 2017
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Macrophages exposed to HIV viral protein disrupt lung epithelial cell integrity and mitochondrial bioenergetics via exosomal microRNA shuttling
Yuan, Petree, Lee et al
Cell Death Dis (2019) 10 (8), 580 DOI: 10.1038/s41419-019-1803-y
AI Summary: OriGene's pMirTarget, pMirTarget-wt-PPARγ-3′-UTR, and pMirTarget-wt-ZO-1-3′-UTR plasmids were used in dual-luciferase assays to investigate how exosomal miR-23a and miR-27a from HIV-exposed macrophages affect lung epithelial cell gene regulation in this study.
Snippet: ). All slides were visualized by using Olympus FV1000 confocal microscope (Japan). Dual-luciferase assay pMirTarget, pMirTarget-wt-PPARγ-3′-UTR, and pMirTarget-wt-ZO-1-3′-UTR were obtained from OriGene Technologies (USA). By using Lipofectamine 3000 (Invitrogen, USA), BEAS-2B cells were transfected with the miR-27a mimic and miR-23a mimic, as well as Cy3-dye-labeled negative pre-miR contr
FigureFigureFigure
Hypoxic lung cancer-secreted exosomal miR-23a increased angiogenesis and vascular permeability by targeting prolyl hydroxylase and tight junction protein ZO-1
Hsu, Hung, Chang et al
Oncogene (2017)
AI Summary: OriGene's EGLN2 and TJP1 3′UTR luciferase plasmids were used in this study to assess how exosomal miR-23a from hypoxic lung cancer cells directly targets and regulates prolyl hydroxylase 2 (EGLN2) and the tight junction protein ZO-1 (TJP1), thereby contributing to increased angiogenesis and vascular permeability.
Snippet: HUVEC were maintained at 50−60% confluence and co-transfected with control, EGLN2 or TJP1 3′UTR luciferase plasmid (Origene, Rockville, MD, USA)/Renilla luciferase plasmid and control miRNA or miR-23a mimics using DharmaFECT duo transfection reagent ... All 3 versions Cite SaveSaving
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products