OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Choline kinase alpha (CHKA) (NM_001277) Human 3' UTR Clone

Be the first to review this product
SKU
SC212759
3' UTR clone of choline kinase alpha (CHKA) transcript variant 1 for miRNA target validation
  $683.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PR300001 Firefly luciferase assay kit, 150 assays
1 kit
$235.00

Other products for "Choline kinase alpha or NM_001277"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol Choline kinase alpha
Synonyms CHK; CK; CKI; EK
ACCN NM_001277
Insert Size 1159 bp
Sequence Data
Insert Sequence
>SC212759 3’UTR clone of NM_001277
The sequence shown below is from the reference sequence of NM_001277. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTCCACCAGAAGAGGAAGCTTGGGGTGTGACTGTGGGGAGGACTCCATCCACCTCATCACTGGACTGCA
TGGGGAGGCAGCAGAGCGGGGTCCCCTCTGTGCTTCGACTACTGCTCCTGTGGCAGGAGGCTTTGGGTG
GCTCACTACTGAACACATGTGTATGATACTAAAGACGGTATTAAAATGGAGCGACGTTTATTTCATCTC
TTGTTTACGATTTCACTAGGACTCAGAAACGAGATCGGGAAGCAGAAATATAGTGCAATAGTGCAACAT
CTCTGAATCCTTTTAATCTAGAGAAGGCATTTCATATTTGGGGGCTAAGGTTTCCAGTCAGATGAGGCA
AACAGCAAGAGTAAGCAGTGTTACTTGCAGGTACTTTGGTTAATGTTGATTTAAATTTTCATGAATGTG
CTGGTGAACACTGTGACCAGGCTTTTGTAGATGGCGATGTGTTATAGACGGTGCTCACTCCCAAGGGAC
AGCAAGTGAGCAGAGATGTACTGCAAAGTCGCCAGTCACTGCTGCAAGGTGGCCTCTGCCTGGGGCCTC
CAGAAGCTGCTCCTTTACCCTCTTGGTCCCATGGCTGAAGCTGGAGCAGCGGATTGCTCTGGAGCAGCC
AAGGCCGCCAGCGTGTGGAGCAGAGCTCTCCCCTCCTGCTGGGCGTGTGTGACACTGATGAGTTTCACT
GTACTGCATGTGACTTCTCCCCTGCCCTTCCTCCTGATGGAGTGTGCAGACAGCCATGCGTGGCCACGG
GGGCAGTGTGAGGACCTCCCTGTCTCCCGGCTCCCCTCCCAGGGGAGCCAGCTGCTTGACCTAGCTCTT
TGGGCCTCTCCTGCCCTCTGCTCTGCCTGGAGTGTCGGATCCTGTGAGTAGGCTGGGCCTCCCCTGGGC
AGGGTTCTCCAAGGGCCCGGTTTCCCGGCCCTTACCTTTCCTGATGCCCCTGACATCATCATTCTTGTG
GGAGACAGCAGCCTGTATGTGGTGTGGGGCGTGGATCGAGTGTAGCTGTGAAATCCATATATATGAAAT
GTCCTGCGGGATACAGTCTTAGCTGACTTTTTTTTACTCTGAACTCTTATTTGAATTGTTTTTTGTGCA
TATATTTCTGCTACCACAGAGATTGTACTATACAAATAAAAAAATAAAAACCCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001277.3
Locus ID 1119
MW 43
Summary The major pathway for the biosynthesis of phosphatidylcholine occurs via the CDP-choline pathway. The protein encoded by this gene is the initial enzyme in the sequence and may play a regulatory role. The encoded protein also catalyzes the phosphorylation of ethanolamine. Two transcript variants encoding different isoforms have been found for this gene. provided by RefSeq, Jul 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

MicroRNA-367-3p induces apoptosis and suppresses migration of MCF-7 cells by downregulating the expression of human choline kinase α
Raikundalia, Sa'Dom, Few et al
Oncol Lett (2021) 21 (3), 183 DOI: 10.3892/ol.2021.12444
Cited by 9
AI Summary: In this study, OriGene products—specifically the human CHKA cDNA clone and anti-CHKA antibody—were used to assess the expression and regulation of choline kinase α (CHKA) in MCF-7 cells, supporting the investigation of miR-367-3p’s effects on CHKA expression, apoptosis, and cell migration.
FigureFigureFigure
MicroRNA‑367‑3p induces apoptosis and suppresses migration of MCF‑7 cells by downregulating the expression of human choline kinase α
Raikundalia, Mohamed Sa'dom, Few et al
Oncol Lett (2021) 21 (3) DOI: 10.3892/ol.2021.12444
Cited by 9
AI Summary: OriGene’s pMirTarget-chka−3′-UTR luciferase reporter construct (cat. no. SC212759) was used in this study to assess the regulation of choline kinase α by miR-367-3p in MCF-7 breast cancer cells.
Snippet: The miRNA mimic was reconstituted in 1X siRNA buffer provided by the manufacturer. The firefly luciferase reporter construct containing the 3′-UTR of the chka gene (pMirTarget-chka−3′-UTR) was purchased from OriGene Technologies, Inc. (cat. no. SC212759)
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products