OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

TJP2 (NM_201629) Human 3' UTR Clone

Be the first to review this product
SKU
SC210301
3' UTR clone of tight junction protein 2 (zona occludens 2) (TJP2) transcript variant 2 for miRNA target validation
  $683.00
4 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PR300001 Firefly luciferase assay kit, 150 assays
1 kit
$235.00

Other products for "TJP2 or NM_201629"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol TJP2
Synonyms C9DUPq21.11; DFNA51; DUP9q21.11; FHCA1; PFIC4; X104; ZO2
ACCN NM_201629
Insert Size 865 bp
Sequence Data
Insert Sequence
>SC210301 3' UTR clone of NM_201629
The sequence shown below is from the reference sequence of NM_201629. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GCCAGTCTGCCCGATACCGGGACACAGAATTATAGATGTCTGAGCACGGACTCTCCCAGGCCTGCCTGCA
TGGCATCAGACTAGCCACTCCTGCCAGGCCGCCGGGATGGTTCTTCTCCAGTTAGAATGCACCATGGAGA
CGTGGTGGGACTCCAGCTCGTGTGTCCTCATGGAGAACCCAGGGGACAGCTGGTGCAAATTCAGAACTGA
GGGCTCTGTTTGTGGGACTGGGTTAGAGGAGTCTGTGGCTTTTTGTTCAGAATTAAGCAGAACACTGCAG
TCAGATCCTGTTACTTGCTTCAGTGGACCGAAATCTGTATTCTGTTTGCGTACTTGTAATATGTATATTA
AGAAGCAATAACTATTTTTCCTCATTAATAGCTGCCTTCAAGGACTGTTTCAGTGTGAGTCAGAATGTGA
AAAAGGAATAAAAAATACTGTTGGGCTCAAACTAAATTCAAAGAAGTACTTTATTGCAACTCTTTTAAGT
GCCTTGGATGAGAAGTGTCTTAAATTTTCTTCCTTTGAAGCTTTAGGCAGAGCCATAATGGACTAAAACA
TTTTGACTAAGTTTTTATACCAGCTTAATAGCTGTAGTTTTCCCTGCACTGTGTCATCTTTTCAAGGCAT
TTGTCTTTGTAATATTTTCCATAAATTTGGACTGTCTATATCATAACTATACTTGATAGTTTGGCTATAA
GTGCTCAATAGCTTGAAGCCCAAGAAGTTGGTATCGAAATTTGTTGTTTGTTTAAACCCAAGTGCTGCAC
AAAAGCAGATACTTGAGGAAAACACTATTTCCAAAAGCACATGTATTGACAACAGTTTTATAATTTAATA
AAAAGGAATACATTGCAATCCGTAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_201629.2
Locus ID 9414
Summary This gene encodes a zonula occluden that is a member of the membrane-associated guanylate kinase homolog family. The encoded protein functions as a component of the tight junction barrier in epithelial and endothelial cells and is necessary for proper assembly of tight junctions. Mutations in this gene have been identified in patients with hypercholanemia, and genomic duplication of a 270 kb region including this gene causes autosomal dominant deafness-51. Alternatively spliced transcripts encoding multiple isoforms have been observed for this gene. provided by RefSeq, Nov 2011
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products