OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

DAP5 (EIF4G2) (NM_001418) Human 3' UTR Clone

Be the first to review this product
SKU
SC209719
3' UTR clone of eukaryotic translation initiation factor 4 gamma 2 (EIF4G2) transcript variant 1 for miRNA target validation
  $683.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PR300001 Firefly luciferase assay kit, 150 assays
1 kit
$235.00

Other products for "DAP5 or NM_001418"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol DAP5
Synonyms AAG1; DAP5; NAT1; P97
ACCN NM_001418
Insert Size 789 bp
Sequence Data
Insert Sequence
>SC209719 3' UTR clone of NM_001418
The sequence shown below is from the reference sequence of NM_001418. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CAGAGGAAGAAGCTGACTAAAGAACCAGCCAAAGCCTTAAATTGTGCAAAACATACTGTTGCTATGATGT
AACTGCATTTGACCTAACCACTGCGAAAATTCATTCCGCTGTAATGTTTTCACAATATTTAAAGCAGAAG
CACGTCAGTTAGGATTTCCTTCTGCATAAGGTTTTTTTGTAGTGTAATGTCTTAATCATAGTCTACCATC
AAATATTTTAGGAGTATCTTTAATGTTTAGATAGTATATTAGCAGCATGCAATAATTACATCATAAGTTC
TCAAGCAGAGGCAGTCTATTGCAAGGACCTTCTTTGCTGCCAGTTATCATAGGCTGTTTTAAGTTAGAAA
ACTGAATAGCAACACTGAATACTGTAGAAATGCACTTTGCTCAGTAATACTTGAGTTGTTGCAATATTTG
ATTATCCATTTGGTTGTTACAGAAAAATTCTTAACTGTAATTGATGGTTGTTGCCGTAATAGTATATTGC
CTGTATTTCTACCTCTAGTAATGGGCTTTATGTGCTAGATTTTAATATCCTTGAGCCTGGGCAAGTGCAC
AAGTCTTTTTAAAAGAAACATGGTTTACTTGCACAAAACTGATCAGTTTTGAGAGATCGTTAATGCCCTT
GAAGTGGTTTTTGTGGGTGTGAAACAAATGGTGAGAATTTGAATTGGTCCCTCCTATTATAGTATTGAAA
TTAAGTCTACTTAATTTATCAAGTCATGTTCATGCCCTGATTTTATATACTTGTATCTATCAATAAACAT
TGTGATACTTGATGTAGTG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001418.3
Locus ID 1982
Summary Translation initiation is mediated by specific recognition of the cap structure by eukaryotic translation initiation factor 4F (eIF4F), which is a cap binding protein complex that consists of three subunits: eIF4A, eIF4E and eIF4G. The protein encoded by this gene shares similarity with the C-terminal region of eIF4G that contains the binding sites for eIF4A and eIF3; eIF4G, in addition, contains a binding site for eIF4E at the N-terminus. Unlike eIF4G, which supports cap-dependent and independent translation, this gene product functions as a general repressor of translation by forming translationally inactive complexes. In vitro and in vivo studies indicate that translation of this mRNA initiates exclusively at a non-AUG (GUG) codon. Alternatively spliced transcript variants encoding different isoforms of this gene have been described. provided by RefSeq, Jul 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products