OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Plakophilin 4 (PKP4) (NM_003628) Human 3' UTR Clone

Be the first to review this product
SKU
SC209690
3' UTR clone of plakophilin 4 (PKP4) transcript variant 1 for miRNA target validation
  $683.00
4 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PR300001 Firefly luciferase assay kit, 150 assays
1 kit
$235.00

Other products for "Plakophilin 4 or NM_003628"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol Plakophilin 4
Synonyms p0071
ACCN NM_003628
Insert Size 782 bp
Sequence Data
Insert Sequence
>SC209690 3’UTR clone of NM_003628
The sequence shown below is from the reference sequence of NM_003628. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TACCCAGGGTCCCCAGACTCATGGGTGTAGCATCAAGATGCCCAACAGAGGAACTCTTTCTTTCTAACC
TTGTTCAGATTGAGGTGAAAAGTCCATCTTGCTGATTTGATGATTGAAATGTGAAAGTGAAGTGGAAGG
AATGAATGAAGTGTGTTTTTTTTTTCTTTTTTGAGGAATTATCAGGGAAGTGAGGAAATGTTTGGGAGA
GGACTTTCTAAGCTCTATTTAGGTGTTAGATCTAATTACTTATAGATTCTGTAGTCTGGTGAAGGTGTG
GGTGACGTGATGAGAGGTTTGAGAAATGGGTGAAATGAAATGGGGGATATGTAGGTCAAATCAAATTAA
AGATGATTTTTTTAATGTGAATAAAGTTATGTTCTGATAGTTTGTACAGAAAAAATAAAATGGATGCCC
ATGTTTTATTGCTATTACTAAATGTCAAGATTGTATGCTATTATGTCTTGTAAATTTCTTTTGTTGGTG
TAAATATGGAAATGCCACATTGGTTAAGTGCCATCATTTGTAATGCAATGTGTCACTTGAAAAGAGATT
TGAAGAAACTGACAACTTCAAAAACAAATGAGAAGCCCAAGGAACTGTGAGCAATTAAAAGCAAACCGC
GACACCCTTTGTCTCCACCACACATAGTGTACTTTGGAAGCACAACGTCCAGGCTGGTACCGCAGCGCC
ATGCCCATTCCTCGCCTCATTCATAGGACACTTCACTGCCATTTTCTATTCACATAAAAGAAAAATAAA
TGTGGAAATTTCATCCTTGGAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_003628.6
Locus ID 8502
MW 30.6
Summary Armadillo-like proteins are characterized by a series of armadillo repeats, first defined in the Drosophila 'armadillo' gene product, that are typically 42 to 45 amino acids in length. These proteins can be divided into subfamilies based on their number of repeats, their overall sequence similarity, and the dispersion of the repeats throughout their sequences. Members of the p120(ctn)/plakophilin subfamily of Armadillo-like proteins, including CTNND1, CTNND2, PKP1, PKP2, PKP4, and ARVCF. PKP4 may be a component of desmosomal plaque and other adhesion plaques and is thought to be involved in regulating junctional plaque organization and cadherin function. Multiple transcript variants encoding different isoforms have been found for this gene. provided by RefSeq, Feb 2015
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products