OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Beclin 1 (BECN1) (NM_003766) Human 3' UTR Clone

Be the first to review this product
SKU
SC208275
3' UTR clone of beclin 1 autophagy related (BECN1) for miRNA target validation
  $683.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PR300001 Firefly luciferase assay kit, 150 assays
1 kit
$235.00

Other products for "Beclin 1 or NM_003766"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol Beclin 1
Synonyms ATG6; beclin1; VPS30
ACCN NM_003766
Insert Size 661 bp
Sequence Data
Insert Sequence
>SC208275 3' UTR clone of NM_003766
The sequence shown below is from the reference sequence of NM_003766. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TTGCTTGGGTGTCCTCACAATTTTATAACAAATGACTTTTTTCCTTAGGGGGAGGTTTGCCTTAAAGGCT
TTTAATTTTGTTTTGTTTGCAAACATGTTTTAAATTAAATTCGGGTAATATTAAACAGTACATGTTTACA
ATACCAAAAAAGAAAAAATCCACAAAAGCCACTTTATTTTAAAATATCATGTGACAGATACTTTCCAGAG
CTACAACATGCCATCTATAGTTGCCAGCCCTGGTCAGTTTTGATTCTTAACCCCATGGACTCCTTTCCCT
TTCTTCTCTGAAAAAAACTAATTTAAATTTGCTTTTCTTTTTTTTAACTGAGTTGAATTGAGATTGATGT
GTTTTCACTGGATTTTTATCTCTCTCAACTTCCTGCACTTAACAATATGAAATAGAAACTTTTGTCTTTA
CTGAGATGAGGATATGTTTGAGATGCACAGTTGGATAATGTGGGAAAATGACATCTAAGCTTTACCTGGT
CACCATGTGATGTGATCAGATGCTTGAAATTTAACACTTTTCACTTGGTTCTTATACTGAATGCCGACTC
TGCTCTGTGTTAGAGATATGAAATGGTGTTTGATACTGTTTGAGACATTATGGAGAGATTTAATTATTTG
TAATAAAAGATTTGCTGCAGTCTGAAAACTG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_003766.3
Locus ID 8678
Summary This gene encodes a protein that regulates autophagy, a catabolic process of degradation induced by starvation. The encoded protein is a component of the phosphatidylinositol-3-kinase (PI3K) complex which mediates vesicle-trafficking processes. This protein is thought to play a role in multiple cellular processes, including tumorigenesis, neurodegeneration and apoptosis. Alternative splicing results in multiple transcript variants. provided by RefSeq, Sep 2015
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

mda-7/IL-24 Mediates Cancer Cell-Specific Death via Regulation of miR-221 and the Beclin-1 Axis
Pradhan, Talukdar, Bhoopathi et al
Cancer Res. (2017) 77 (4), 949-959 DOI: 10.1158/0008-5472.CAN-16-1731
AI Summary: OriGene contributed the Beclin-1 3'UTR construct to this study, which was used to investigate the regulatory relationship between miR-221 and Beclin-1 in cancer cell death mediated by mda-7/IL-24.
Snippet: ...Beclin-1 3UTR construct was from Origene. Beclin-1 construct was...previously (29). The primary antibodies used in this study were MDA-7...beclin-1 (Abcam). Secondary antibodies used in this study were from...beclin-1, p27, and PUMA antibodies. EF1alpha was used as a loading...
FigureFigure
MiR-216a: a link between endothelial dysfunction and autophagy
Menghini, Casagrande, Marino et al
Cell Death Dis (2014) 5, e1029 DOI: 10.1038/cddis.2013.556
Cited by 145
AI Summary: OriGene products contributed to this study by providing the pGL3-BECN1-3′-UTR, pGL3-ATG5-3′-UTR, and pGL3-BECN1mut-3′-UTR luciferase reporter vectors, which were used to investigate the direct targeting of autophagy-related genes by miR-216a.
Snippet: St Louis, MO, USA). Luciferase assay. The pGL3-BECN1-3′-UTR, pGL3-ATG5-3′-UTR and pGL3-BECN1mut-3′-UTR vectors were obtained from Origene Technologies Inc. (Rockville, MD, USA). Each vector, along with ... Related articles Cite SaveSaving
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products