OriGene Logo

Annexin V (ANXA5) (NM_001154) Human 3' UTR Clone

Be the first to review this product
SKU
SC206685
3' UTR clone of annexin A5 (ANXA5) for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "Annexin V or NM_001154"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol Annexin V
Synonyms ANX5; ENX2; HEL-S-7; PP4; RPRGL3
ACCN NM_001154
Insert Size 552 bp
Sequence Data
Insert Sequence
>SC206685 3’UTR clone of NM_001154
The sequence shown below is from the reference sequence of NM_001154. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTTCTGCTGCTCTGTGGAGAAGATGACTAACGTGTCACGGGGAAGAGCTCCCTGCTGTGTGCCTGCACC
ACCCCACTGCCTTCCTTCAGCACCTTTAGCTGCATTTGTATGCCAGTGCTTAACACATTGCCTTATTCA
TACTAGCATGCTCATGACCAACACATACACGTCATAGAAGAAAATAGTGGTGCTTCTTTCTGATCTCTA
GTGGAGATCTCTTTGACTGCTGTAGTACTAAAGTGTACTTAATGTTACTAAGTTTAATGCCTGGCCATT
TTCCATTTATATATATTTTTTAAGAGGCTAGAGTGCTTTTAGCCTTTTTTAAAAACTCCATTTATATTA
CATTTGTAACCATGATACTTTAATCAGAAGCTTAGCCTTGAAATTGTGAACTCTTGGAAATGTTATTAG
TGAAGTTCGCAACTAAACTAAACCTGTAAAATTATGATGATTGTATTCAAAAGATTAATGAAAAATAAA
CATTTCTGTCCCCCTGAATTATGTGTACATGTGTGTTTAGATTTATTATTAAATTTATTTAACAATGTT
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001154.4
Locus ID 308
Summary The Annexin 5 gene spans 29 kb containing 13 exons, and encodes a single transcript of approximately 1.6 kb and a protein product with a molecular weight of about 35 kDa.The protein encoded by this gene belongs to the annexin family of calcium-dependent phospholipid binding proteins some of which have been implicated in membrane-related events along exocytotic and endocytotic pathways. Annexin 5 is a phospholipase A2 and protein kinase C inhibitory protein with calcium channel activity and a potential role in cellular signal transduction, inflammation, growth and differentiation. Annexin 5 has also been described as placental anticoagulant protein I, vascular anticoagulant-alpha, endonexin II, lipocortin V, placental protein 4 and anchorin CII. Polymorphisms in this gene have been implicated in various obstetric complications. [provided by RefSeq, Dec 2019]
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.