OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

ATP6V1H (NM_015941) Human 3' UTR Clone

Be the first to review this product
SKU
SC205683
3' UTR clone of ATPase H+ transporting lysosomal 50/57kDa V1 subunit H (ATP6V1H) transcript variant 1 for miRNA target validation
  $683.00
4 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PR300001 Firefly luciferase assay kit, 150 assays
1 kit
$235.00

Other products for "ATP6V1H or NM_015941"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol ATP6V1H
Synonyms CGI-11; MSTP042; NBP1; SFD; SFDalpha; SFDbeta; VMA13
ACCN NM_015941
Insert Size 451 bp
Sequence Data
Insert Sequence
>SC205683 3’UTR clone of NM_015941
The sequence shown below is from the reference sequence of NM_015941. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CAGCCCCAGACCGCTGCCGCCCGAAGCTAAGCCTGCCTCTGGCCTTCCCCTCCGCCTCAATGCAGAACC
AGTAGTGGGAGCACTGTGTTTAGAGTTAAGAGTGAACACTGTTTGATTTTACTTGGAATTTCCTCTGTT
ATATAGCTTTTCCCAATGCTAATTTCCAAACAACAACAACAAAATAACATGTTTGCCTGTTAAGTTGTA
TAAAAGTAGGTGATTCTGTATTTAAAGAAAATATTACTGTTACATATACTGCTTGCAATTTCTGTATTT
ATTGTTCTCTGGAAATAAATATAGTTATTAAAGGATTCTCACTCCAAACATGGCCTCTCTCTTTACTTG
GACTTTGAACAAAAGTCAACTGTTGTCTCTTTTCAAACCAAATTGGGAGAATTGTTGCAAAGTAGTGAA
TGGCAAATAAATGTTTTAAAATCTATCGCTCTATCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_015941.4
Locus ID 51606
MW 16.9
Summary This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of intracellular organelles. V-ATPase-dependent organelle acidification is necessary for multiple processes including protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. The encoded protein is the regulatory H subunit of the V1 domain of V-ATPase, which is required for catalysis of ATP but not the assembly of V-ATPase. Decreased expression of this gene may play a role in the development of type 2 diabetes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. provided by RefSeq, May 2012
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products