OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

delta Sarcoglycan (SGCD) (NM_172244) Human 3' UTR Clone

Be the first to review this product
SKU
SC203681
3' UTR clone of sarcoglycan delta (35kDa dystrophin-associated glycoprotein) (SGCD) transcript variant 2 for miRNA target validation
  $683.00
4 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PR300001 Firefly luciferase assay kit, 150 assays
1 kit
$235.00

Other products for "delta Sarcoglycan or NM_172244"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol delta Sarcoglycan
Synonyms 35DAG; CMD1L; DAGD; LGMDR6; SG-delta; SGCDP; SGD
ACCN NM_172244
Insert Size 313 bp
Sequence Data
Insert Sequence
>SC203681 3’UTR clone of NM_172244
The sequence shown below is from the reference sequence of NM_172244. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AACAGGCCAACCCTTCCCATAACTGGTTGACCTCGGAGTTGGATCCTACAGTGTATCAACAAAAGGAGC
CAAGCAGGTTTTATTTCTGAAACAATTAATTGAGCAGCATGATTATAAGCCAAACCCACAATCCATCAA
AGTGATGATTTCTTATTTGTAAAATGCAGAGATAATGGCATGTATTCCAAGTACAGAATTATATGACCA
TGAAAATGAATGCTATTTTCAAATTCTCTCTTGTCACCTTAAAATAAGATTTTGTTAGCCAACATAATT
AAGCTGTATATATTATACACATCTGGCTCAAGATGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_172244.3
Locus ID 6444
MW 11.7
Summary The protein encoded by this gene is one of the four known components of the sarcoglycan complex, which is a subcomplex of the dystrophin-glycoprotein complex (DGC). DGC forms a link between the F-actin cytoskeleton and the extracellular matrix. This protein is expressed most abundantly in skeletal and cardiac muscle. Mutations in this gene have been associated with autosomal recessive limb-girdle muscular dystrophy and dilated cardiomyopathy. Alternatively spliced transcript variants encoding distinct isoforms have been observed for this gene. provided by RefSeq, Jul 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products