IER5 Human siRNA Oligo Duplex (Locus ID 51278)
$518.00
3 Weeks*
Specifications
| Product Data | |
| Purity | HPLC purified |
|---|---|
| Quality Control | Tested by ESI-MS |
| Sequences | Available with shipment |
| Components |
IER5 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each (Locus ID 51278)Included - SR30004, Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmolIncluded - SR30005, RNAse free siRNA Duplex Resuspension Buffer - 2 ml
|
| Stability | One year from date of shipment when stored at -20°C. |
| Shipping | Ambient |
| # of Transfections | Approximately 330 transfections/2nmol in 24-well plate under optimized conditions (final conc. 10 nM). |
| Note | Single siRNA duplex (10nmol) can be ordered. |
| Reference Data | |
| RefSeq | NM_016545 |
| UniProt ID | Q5VY09 |
| Synonyms | SBBI48 |
| Summary | This gene encodes a protein that is similar to other immediate early response proteins. In the mouse, a similar gene may play an important role in mediating the cellular response to mitogenic signals. Studies in rats found the expression of a similar gene to be increased after waking and sleep deprivation. provided by RefSeq, Jul 2008 |
| Performance Guaranteed | OriGene guarantees that at least two of the three Dicer-Substrate duplexes in the kit will provide at least 70% or more knockdown of the target mRNA when used at 10 nM concentration by quantitative RT-PCR when the TYE-563 fluorescent transfection control duplex (cat# SR30002) indicates that >90% of the cells have been transfected and the HPRT positive control (cat# SR30003) provides 90% knockdown efficiency. For non-conforming siRNA, requests for replacement product must be made within ninety (90) days from the date of delivery of the siRNA kit. To arrange for a free replacement with newly designed duplexes, please contact Technical Services at techsupport@origene.com. Please provide your data indicating the transfection efficiency and measurement of gene expression knockdown compared to the scrambled siRNA control (quantitative RT-PCR data required). |
Reviews
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Citations
Novel role of PAF1 in attenuating radiosensitivity in cervical cancer by inhibiting IER5 transcription
Zheng, He, Liu et al
Radiat Oncol (2020) 15 (1), 131 DOI: 10.1186/s13014-020-01580-w
Zheng, He, Liu et al
Radiat Oncol (2020) 15 (1), 131 DOI: 10.1186/s13014-020-01580-w
Cited by 14
AI Summary: OriGene contributed to this study by providing specific siRNAs targeting PAF1 (si-PAF1), IER5 (si-IER5), and a universal scrambled control siRNA, which were used to investigate the roles of these genes in cervical cancer cell radiosensitivity.
Snippet: Specific siRNAs were purchased from OriGene: CGAGUCAAGUACUGCAAUAGCCUCC (si-PAF1), CCUCAUCAGCAUCUUCGGUUU (si-IER5), and a universal scrambled control siRNA duplex was also obtained from OriGene. Transfection was performed using Lipofectamine 3000 (Invitrogen) following the manufacturer’s recommendations. Cells were harvested 48 h after transfection and subjected to different further assays
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.
Related Products
- Price:
- Actual Price:
Welcome to OriGene AI!
I'm your AI-powered guide to everything OriGene.
Ask me anything:
- Product specs
- Ordering help
- Technical questions
- How to find exactly what your experiment needs
Prefer a live agent? Connect with us by clicking the green chat icon, as seen in the image below or email our team at custsupport@origene.com.
