PHF8 Human siRNA Oligo Duplex (Locus ID 23133)
$518.00
In Stock*
Specifications
| Product Data | |
| Purity | HPLC purified |
|---|---|
| Quality Control | Tested by ESI-MS |
| Sequences | Available with shipment |
| Components |
PHF8 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each (Locus ID 23133)Included - SR30004, Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmolIncluded - SR30005, RNAse free siRNA Duplex Resuspension Buffer - 2 ml
|
| Stability | One year from date of shipment when stored at -20°C. |
| Shipping | Ambient |
| # of Transfections | Approximately 330 transfections/2nmol in 24-well plate under optimized conditions (final conc. 10 nM). |
| Note | Single siRNA duplex (10nmol) can be ordered. |
| Reference Data | |
| RefSeq | NM_001184896, NM_001184897, NM_001184898, NM_015107 |
| UniProt ID | Q9UPP1 |
| Synonyms | JHDM1F; KDM7B; MRXSSD; ZNF422 |
| Summary | The protein encoded by this gene is a histone lysine demethylase that preferentially acts on histones in the monomethyl or dimethyl states. The encoded protein requires Fe(2+) ion, 2-oxoglutarate, and oxygen for its catalytic activity. The protein has an N-terminal PHD finger and a central Jumonji C domain. This gene is thought to function as a transcription activator. Defects in this gene are a cause of syndromic X-linked Siderius type intellectual disability (MRXSSD) and over-expression of this gene is associated with several forms of cancer. Multiple transcript variants encoding different isoforms have been found for this gene. provided by RefSeq, Jul 2017 |
| Performance Guaranteed | OriGene guarantees that at least two of the three Dicer-Substrate duplexes in the kit will provide at least 70% or more knockdown of the target mRNA when used at 10 nM concentration by quantitative RT-PCR when the TYE-563 fluorescent transfection control duplex (cat# SR30002) indicates that >90% of the cells have been transfected and the HPRT positive control (cat# SR30003) provides 90% knockdown efficiency. For non-conforming siRNA, requests for replacement product must be made within ninety (90) days from the date of delivery of the siRNA kit. To arrange for a free replacement with newly designed duplexes, please contact Technical Services at techsupport@origene.com. Please provide your data indicating the transfection efficiency and measurement of gene expression knockdown compared to the scrambled siRNA control (quantitative RT-PCR data required). |
Reviews
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Citations
c-MYC drives histone demethylase PHF8 during neuroendocrine differentiation and in castration-resistant prostate cancer
Maina, Shao, Liu et al
Oncotarget (2016) 7 (46), 75585-75602 DOI: 10.18632/oncotarget.12310
Maina, Shao, Liu et al
Oncotarget (2016) 7 (46), 75585-75602 DOI: 10.18632/oncotarget.12310
Snippet: miR-22 mimics (GenePharma) or inhibitors (Integrated DNA Technologies) were used at a final concentration of 20 nM or 50 nM, respectively. siRNA duplexes (OriGene and Sigma) targeting the human AR (siRNA1 GCCUUUAAAUCUGUGAUGAUCCUCA,
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.
Related Products
- Price:
- Actual Price:
Welcome to OriGene AI!
I'm your AI-powered guide to everything OriGene.
Ask me anything:
- Product specs
- Ordering help
- Technical questions
- How to find exactly what your experiment needs
Prefer a live agent? Connect with us by clicking the green chat icon, as seen in the image below or email our team at custsupport@origene.com.
