OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Ahnak2 Mouse shRNA Plasmid (Locus ID 100041194)

Be the first to review this product
SKU
TR512658
Ahnak2 - Mouse, 4 unique 29mer shRNA constructs in retroviral untagged vector, 5µg of each construct provided
  $883.00
2 Weeks*

Frequently Bought Together (1)

TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Ahnak2 or NM_001033476"

Specifications
Specifications
Product Data
Locus ID 100041194
Synonyms AI450948, Gm1185
Vector pRS
E. coli Selection Ampicillin
Mammalian Cell Selection Puromycin
Format Retroviral plasmids
Components Ahnak2 - Mouse, 4 unique 29mer shRNA constructs in retroviral untagged vector(Gene ID = 100041194). 5µg purified plasmid DNA per construct
29-mer scrambled shRNA cassette in pRS Vector, TR30012, included for free.
RefSeq NM_001033476, BC138468, BC138469
shRNA Design These shRNA constructs were designed against multiple splice variants at this gene locus. To be certain that your variant of interest is targeted, please contact techsupport@origene.com. If you need a special design or shRNA sequence, please utilize our custom shRNA service.
Storage Store at -20°C
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

AHNAK2 Participates in the Stress-Induced Nonclassical FGF1 Secretion Pathway
Kirov, Kacer, Conley et al
J. Cell. Biochem. (2015)
Cited by 27
AI Summary: OriGene’s pGFP-V-RS shRNA constructs targeting mouse AHNAK2 were used in this study to deplete AHNAK2 expression, enabling the authors to demonstrate AHNAK2's crucial role in stress-induced FGF1 secretion.
Snippet: 2011). Genetic constructs pGFP-V-RS expressing shRNAs that suppress the expression of mouse AHNAK2 were obtained from Origene (Rockville, MD). The following AHNAK2-specific sequences were used: 1. 5'- TGCTGAGATGGAGGCTAGAACAGGAAGCT ... Related articles All 3 versions Cite SaveSaving
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products