OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Runx2 Mouse shRNA Plasmid (Locus ID 12393)

Be the first to review this product
SKU
TR510502
Runx2 - Mouse, 4 unique 29mer shRNA constructs in retroviral untagged vector, 5µg of each construct provided
  $883.00
In Stock*

Frequently Bought Together (1)

TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Runx2 or NM_001145920"

Specifications
Specifications
Product Data
Locus ID 12393
Synonyms AM; AML3; Cbf; Cbfa; Cbfa-1; Cbfa1; LS3; Os; Osf2; PEB; Pebp2a1; PEBP2aA; Pebpa2a
Vector pRS
E. coli Selection Ampicillin
Mammalian Cell Selection Puromycin
Format Retroviral plasmids
Components Runx2 - Mouse, 4 unique 29mer shRNA constructs in retroviral untagged vector(Gene ID = 12393). 5µg purified plasmid DNA per construct
29-mer scrambled shRNA cassette in pRS Vector, TR30012, included for free.
RefSeq NM_001145920, NM_001146038, NM_001271627, NM_001271630, NM_001271631, NM_009820, NR_073392, NR_073425, NM_001146038.1, NM_001146038.2, NM_009820.1, NM_009820.2, NM_009820.3, NM_009820.4, NM_009820.5, NM_001145920.1, NM_001145920.2, NM_001271631.1, NM_001271630.1, NM_001271627.1, BC172607, BC172715, NM_001271633
UniProt ID Q08775
Summary This gene encodes a member of the runt domain-containing family of transcription factors. This protein is essential for osteoblastic differentiation and skeletal morphogenesis and acts as a scaffold for nucleic acids and regulatory factors involved in skeletal gene expression. The protein can bind DNA both as a monomer or, with more affinity, as a subunit of a heterodimeric complex. Transcript variants that encode different protein isoforms result from the use of alternate promoters as well as alternate splicing. provided by RefSeq, Sep 2015
shRNA Design These shRNA constructs were designed against multiple splice variants at this gene locus. To be certain that your variant of interest is targeted, please contact techsupport@origene.com. If you need a special design or shRNA sequence, please utilize our custom shRNA service.
Storage Store at -20°C
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Small molecule T63 suppresses osteoporosis by modulating osteoblast differentiation via BMP and WNT signaling pathways
Zhao, Chen, Zhang et al
Sci Rep (2017) 7 (1), 10397 DOI: 10.1038/s41598-017-10929-3
AI Summary: OriGene’s shRNA product (#TR510502) was used to knock down Runx2 gene expression, enabling the authors to demonstrate that T63’s osteogenic effects depend on RUNX2 in their study of osteoporosis treatments.
Snippet: Runx2 gene was knocked down with shRNAs (origene #TR510502), with sequences as follows: GCAAGAGTTTCACCTTGACCATAACAGTC (1#), CCTAGTTTGTTCTCTG-ATCGCCTCAGTGA (2#)
FigureFigureFigure
RUNX2 in subtype specific breast cancer and mammary gland differentiation
McDonald, Ferrari, Terry et al
Dis Model Mech (2014)
Cited by 61
AI Summary: OriGene’s RUNX2 shRNA (HuSH™) and scrambled control were used to transfect MDA-MB-231 breast cancer cells, enabling the study of RUNX2’s functional role in breast cancer cell invasiveness and differentiation.
Snippet: MDA-MB- 231 purchased from American Type Culture Collection. MDA-MB-231 cells were transfected with RUNX2 shRNA and scrambled control (HuSHTM, Origene) through electroporation using Nucleofector Kit V program X-013 (Amaxa, Lonza). ... Cite SaveSaving
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products