OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

PINK1 Human shRNA Plasmid Kit (Locus ID 65018)

Be the first to review this product
SKU
TR320728
PINK1 - Human, 4 unique 29mer shRNA constructs in retroviral untagged vector, 5µg of each construct provided
  $883.00
In Stock*

Frequently Bought Together (1)

TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "PINK1 or NM_032409"

Specifications
Specifications
Product Data
Locus ID 65018
Synonyms BRPK; PARK6
Vector pRS
E. coli Selection Ampicillin
Mammalian Cell Selection Puromycin
Format Retroviral plasmids
Components PINK1 - Human, 4 unique 29mer shRNA constructs in retroviral untagged vector(Gene ID = 65018). 5µg purified plasmid DNA per construct
29-mer scrambled shRNA cassette in pRS Vector, TR30012, included for free.
RefSeq NM_032409, NM_032409.1, NM_032409.2, BC028215, BC028215.1, BC009534, NM_032409.3
UniProt ID Q9BXM7
Summary This gene encodes a serine/threonine protein kinase that localizes to mitochondria. It is thought to protect cells from stress-induced mitochondrial dysfunction. Mutations in this gene cause one form of autosomal recessive early-onset Parkinson disease. provided by RefSeq, Jul 2008
shRNA Design These shRNA constructs were designed against multiple splice variants at this gene locus. To be certain that your variant of interest is targeted, please contact techsupport@origene.com. If you need a special design or shRNA sequence, please utilize our custom shRNA service.
Storage Store at -20°C
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Mitochondrial and lysosomal biogenesis are activated following PINK1/parkin-mediated mitophagy
Ivankovic, Chau, Schapira et al
J. Neurochem. (2015)
Cited by 262
AI Summary: OriGene's HuSH 29mer shRNA constructs (pRS plasmid) targeting PINK1 were used to generate SH-SY5Y cells with constitutive PINK1 knockdown, enabling the study of mitophagy and its effects on mitochondrial and lysosomal biogenesis in this paper.
Snippet: SH-SY5Y cells with constitutive KD of PINK1 were generated using HuSH 29mer shRNA constructs (pRS plasmid;Origene, Rockville, MD, USA) against PINK1 ( GCTGTGTATGAAGCCACCATGCCTACATT) or scrambled negative control shRNA. ... Cite SaveSaving
Loss of PINK1 function promotes mitophagy through effects on oxidative stress and mitochondrial fission
Dagda, Cherra, Kulich et al
J Biol Chem (2009) 284 (20), 13843-13855 DOI: 10.1074/jbc.M808515200
AI Summary: In this paper, OriGene products—specifically, the human PINK1 shRNA plasmid and human PINK1 cDNA (RNAi-resistant) plasmid—were used to stably knock down and reintroduce PINK1 in SH-SY5Y cells, enabling the authors to investigate the effects of PINK1 loss and rescue on mitochondrial dynamics and mitophagy.
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products