OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

TLK1 Human shRNA Plasmid Kit (Locus ID 9874)

Be the first to review this product
SKU
TR320623
TLK1 - Human, 4 unique 29mer shRNA constructs in retroviral untagged vector, 5µg of each construct provided
  $883.00
In Stock*

Frequently Bought Together (2)

TA382561 TLK1 Rabbit polyclonal Antibody
100 ul
$410.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "TLK1 or NM_001136554"

Specifications
Specifications
Product Data
Locus ID 9874
Synonyms PKU-beta
Vector pRS
E. coli Selection Ampicillin
Mammalian Cell Selection Puromycin
Format Retroviral plasmids
Components TLK1 - Human, 4 unique 29mer shRNA constructs in retroviral untagged vector(Gene ID = 9874). 5µg purified plasmid DNA per construct
29-mer scrambled shRNA cassette in pRS Vector, TR30012, included for free.
RefSeq NM_001136554, NM_001136555, NM_012290, NM_012290.1, NM_012290.2, NM_012290.3, NM_012290.4, NM_001136554.1, NM_001136555.1, BC032657, BC032657.1, NM_001136554.2, NM_001136555.2
UniProt ID Q9UKI8
Summary The protein encoded by this gene is a serine/threonine kinase that may be involved in the regulation of chromatin assembly. The encoded protein is only active when it is phosphorylated, and this phosphorylation is cell cycle-dependent, with the maximal activity of this protein coming during S phase. The catalytic activity of this protein is diminished by DNA damage and by blockage of DNA replication. Three transcript variants encoding different isoforms have been found for this gene. provided by RefSeq, Nov 2011
shRNA Design These shRNA constructs were designed against multiple splice variants at this gene locus. To be certain that your variant of interest is targeted, please contact techsupport@origene.com. If you need a special design or shRNA sequence, please utilize our custom shRNA service.
Storage Store at -20°C
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

NEK1 Phosphorylation of YAP Promotes Its Stabilization and Transcriptional Output
Khalil, Ghosh, Singh et al
Cancers (Basel) (2020) 12 (12) DOI: 10.3390/cancers12123666
Cited by 38
AI Summary: OriGene products contributed to this study by providing the wild type human full length NEK1 mammalian expression plasmid (MR216282) and TLK1 shRNA, which were used to investigate the TLK1>NEK1>YAP1 axis in prostate cancer progression.
Snippet: 2.1. Plasmids and Antibodies. Wild type human full length NEK1 mammalian expression plasmid was purchased from Origene (MR216282) TLK1 shRNA ( ATTACTTCATCTGCTTGGTAGAGGTGGCT) was obtained from origene (Rockville, MD, USA Cached
FigureFigureFigure
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products