OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

p53 (TP53) Human shRNA Plasmid Kit (Locus ID 7157)

Be the first to review this product
SKU
TR320558
TP53 - Human, 4 unique 29mer shRNA constructs in retroviral untagged vector, 5µg of each construct provided
  $883.00
In Stock*

Frequently Bought Together (2)

TA502870 TP53 mouse monoclonal antibody, clone OTI5E2 (formerly 5E2) 100 ul
$447.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "p53 or NM_000546"

Specifications
Specifications
Product Data
Locus ID 7157
Synonyms BCC7; BMFS5; LFS1; P53; TRP53
Vector pRS
E. coli Selection Ampicillin
Mammalian Cell Selection Puromycin
Format Retroviral plasmids
Components TP53 - Human, 4 unique 29mer shRNA constructs in retroviral untagged vector(Gene ID = 7157). 5µg purified plasmid DNA per construct
29-mer scrambled shRNA cassette in pRS Vector, TR30012, included for free.
RefSeq NM_000546, NM_001126112, NM_001126113, NM_001126114, NM_001126115, NM_001126116, NM_001126117, NM_001126118, NM_001276695, NM_001276696, NM_001276697, NM_001276698, NM_001276699, NM_001276760, NM_001276761, NM_000546.1, NM_000546.2, NM_000546.3, NM_000546.4, NM_000546.5, NM_001126116.1, NM_001126117.1, NM_001126115.1, NM_001126114.1, NM_001126114.2, NM_001126113.1, NM_001126113.2, NM_001126112.1, NM_001126112.2, NM_001276696.1, NM_001276695.1, NM_001126118.1, NM_001276760.1, NM_001276761.1, NM_001276698.1, NM_001276699.1, NM_001276697.1, BC003596, BC003596.1, NM_000546.6, NM_001276761.2, NM_001276699.2, NM_001276696.2, NM_001276698.2, NM_001276697.2, NM_001276695.2, NM_001276760.2
UniProt ID P04637
Summary This gene encodes a tumor suppressor protein containing transcriptional activation, DNA binding, and oligomerization domains. The encoded protein responds to diverse cellular stresses to regulate expression of target genes, thereby inducing cell cycle arrest, apoptosis, senescence, DNA repair, or changes in metabolism. Mutations in this gene are associated with a variety of human cancers, including hereditary cancers such as Li-Fraumeni syndrome. Alternative splicing of this gene and the use of alternate promoters result in multiple transcript variants and isoforms. Additional isoforms have also been shown to result from the use of alternate translation initiation codons from identical transcript variants (PMIDs: 12032546, 20937277). provided by RefSeq, Dec 2016
shRNA Design These shRNA constructs were designed against multiple splice variants at this gene locus. To be certain that your variant of interest is targeted, please contact techsupport@origene.com. If you need a special design or shRNA sequence, please utilize our custom shRNA service.
Storage Store at -20°C
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

TRIM8 Blunts the Pro-proliferative Action of ΔNp63α in a p53 Wild-Type Background
Caratozzolo, Marzano, Abbrescia et al
Front Oncol (2019) 9, 1154 DOI: 10.3389/fonc.2019.01154
AI Summary: In this study, OriGene’s TRIM8-shRNAs (TR300821) and p53 shRNAs (TR320558) were used to specifically silence TRIM8 and p53 genes, enabling the researchers to investigate the molecular interactions and regulatory mechanisms between TRIM8, ΔNp63α, and p53 in cell proliferation and tumor suppression.
Snippet: Z-VAD-FMK (Sigma) was used for 24 h at the final concentration of 20 μM. TRIM8-shRNAs (TR300821-Origene ): TI303277) TGATAAGACGGAGGATGTCAGCTTCATGA TI303280) CGCAAGATTCTCGTCTGTTCTGTGGACAA;p53 shRNAs (TR320558-Origene ) Cached
FigureFigureFigure
Harnessing the p53-PUMA Axis to Overcome DNA Damage Resistance in Renal Cell Carcinoma
Zhou, Tolstov, Arslan et al
Neoplasia (2014) 16 (12), 1028-35 DOI: 10.1016/j.neo.2014.09.012
Cited by 18
AI Summary: OriGene products contributed to this study by providing Trilencer-27 pooled siRNA duplexes for PUMA knockdown (SR308982) and shRNA constructs for p53 knockdown (TR320558), enabling the authors to investigate the roles of PUMA and p53 in DNA damage resistance in renal cell carcinoma.
Snippet: For knockdown of PUMA, pooled siRNA duplexes (Trilencer-27, OriGene, SR308982) were used. For knockdown of p53, shRNA constructs (TR320558;OriGene) were tested for maximum efficiency, and two were selected for further experiments. ... Cite SaveSaving
Oncomorphic TP53 Mutations in Gynecologic Cancers Lose the Normal Protein: Protein Interactions with the microRNA Microprocessing Complex
Brachova, Mueting, Devor
Journal of Cancer Therapy (2014) 5, 506-516
Snippet: The cell line SKOV3 has a loss of function (LOF, null) TP53 mutation that results in a lack of p53 protein expression. This cell line was used as a model to study the effects of the most common oncomorphic TP53 mutations in endometrial and ovarian tumors by stably expressing the following mutants in TP53: R175H, R248Q, R248Q. … Briefly, a vector containing WT p53 cDNA (Clontech) was subjected to site-directed mutagenesis (Stratagene) according to the manufacturer’s instructions. The cell line UCI-107 was used to study the effect of WT p53 on miRNA processing. WT p53 was knocked down using a shRNA plasmid vector or scrambled control (Origene)
Downregulation of SMG-1 in HPV-positive head and neck squamous cell carcinoma due to promoter hypermethylation correlates with improved survival
Gubanova, Brown, Ivanov et al
Clin. Cancer Res. (2012) 18 (5), 1257-67 DOI: 10.1158/1078-0432.CCR-11-2058
Cited by 13
AI Summary: OriGene provided unique short hairpin RNA (shRNA) constructs against SMG-1 and HPV-16 E6, which were used in this study to investigate the effects of gene knockdown on radiation sensitivity and gene expression in head and neck squamous cell carcinoma.
Snippet: Unique short hairpin RNA (shRNA) constructs against SMG-1 and HPV-16 E6 and HusSH shRNA retroviral cloning vector were obtained from OriGene, packed in 293T retroviral packaging cells (ClonTech) using Lipofectamine and Plus reagent from Invitrogen.
p53 is essential for embelin-induced apoptosis in p53-wildtype prostate cancer cells
Wang, Zhao, Chen et al
Int J Clin Exp Med (2016) 9 (10), 19104-19113
Snippet: Transfection p53 shRNA (RC232563) and wildtype p53 cDNA (TR320558)constructs were purchased from Origene (Rockville, MD). Plasmids were transfected into cellsusing Lipofectamine 2000 (Invitrogen, Carlsbad, CA) following the manufacturer's instructions. ... Cite SaveSaving
Showing 1-5 of 5 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products