OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

ELK1 Human shRNA Plasmid Kit (Locus ID 2002)

Be the first to review this product
SKU
TR320328
ELK1 - Human, 4 unique 29mer shRNA constructs in retroviral untagged vector, 5µg of each construct provided
  $883.00
In Stock*

Frequently Bought Together (1)

TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "ELK1 or NM_001114123"

Specifications
Specifications
Product Data
Locus ID 2002
Vector pRS
E. coli Selection Ampicillin
Mammalian Cell Selection Puromycin
Format Retroviral plasmids
Components ELK1 - Human, 4 unique 29mer shRNA constructs in retroviral untagged vector(Gene ID = 2002). 5µg purified plasmid DNA per construct
29-mer scrambled shRNA cassette in pRS Vector, TR30012, included for free.
RefSeq NM_001114123, NM_001257168, NM_005229, NM_005229.1, NM_005229.2, NM_005229.3, NM_005229.4, NM_001114123.1, NM_001114123.2, NM_001257168.1, BC056150, BC056150.1, BC048296
UniProt ID P19419
Summary This gene is a member of the Ets family of transcription factors and of the ternary complex factor (TCF) subfamily. Proteins of the TCF subfamily form a ternary complex by binding to the the serum response factor and the serum response element in the promoter of the c-fos proto-oncogene. The protein encoded by this gene is a nuclear target for the ras-raf-MAPK signaling cascade. This gene produces multiple isoforms by using alternative translational start codons and by alternative splicing. Related pseudogenes have been identified on chromosomes 7 and 14. provided by RefSeq, Mar 2012
shRNA Design These shRNA constructs were designed against multiple splice variants at this gene locus. To be certain that your variant of interest is targeted, please contact techsupport@origene.com. If you need a special design or shRNA sequence, please utilize our custom shRNA service.
Storage Store at -20°C
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

GADD45α-Targeted Suicide Gene Therapy for the Prevention or Treatment of Non-Small Cell Lung Carcinoma
Shi
Thesis (2015)
Snippet: The pRS shRNA expression vector 40 was obtained from Origene (MD) and the sequence of Elk-1 shRNA CTCGCTGCCTCCTAGCATTCACTTCTGGA was designed using a computer algorithm (Origene Technologies, Inc., MD)
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products