OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

HMGCS2 Human shRNA Plasmid Kit (Locus ID 3158)

Be the first to review this product
SKU
TR312391
HMGCS2 - Human, 4 unique 29mer shRNA constructs in retroviral untagged vector, 5µg of each construct provided
  $883.00
In Stock*

Frequently Bought Together (2)

TA377142 HMGCS2 Rabbit polyclonal Antibody
100 ul
$410.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "HMGCS2 or NM_001166107"

Specifications
Specifications
Product Data
Locus ID 3158
Vector pRS
E. coli Selection Ampicillin
Mammalian Cell Selection Puromycin
Format Retroviral plasmids
Components HMGCS2 - Human, 4 unique 29mer shRNA constructs in retroviral untagged vector(Gene ID = 3158). 5µg purified plasmid DNA per construct
29-mer scrambled shRNA cassette in pRS Vector, TR30012, included for free.
RefSeq NM_001166107, NM_005518, NM_005518.1, NM_005518.2, NM_005518.3, NM_001166107.1, BC044217, BC044217.1, NM_005518.4
UniProt ID P54868
Summary The protein encoded by this gene belongs to the HMG-CoA synthase family. It is a mitochondrial enzyme that catalyzes the first reaction of ketogenesis, a metabolic pathway that provides lipid-derived energy for various organs during times of carbohydrate deprivation, such as fasting. Mutations in this gene are associated with HMG-CoA synthase deficiency. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.provided by RefSeq, Oct 2009
shRNA Design These shRNA constructs were designed against multiple splice variants at this gene locus. To be certain that your variant of interest is targeted, please contact techsupport@origene.com. If you need a special design or shRNA sequence, please utilize our custom shRNA service.
Storage Store at -20°C
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Fsp27/CIDEC is a CREB target gene induced during early fasting in liver and regulated by FA oxidation rate
Vilà-Brau, De Sousa-Coelho, Gonçalves et al
J. Lipid Res. (2013) 54 (3), 592-601 DOI: 10.1194/jlr.M028472
Cited by 2
AI Summary: OriGene’s pGFP-V-RS-shRNA vector (GI579478) was used to generate shRNA targeting mouse Hmgcs2, enabling the study of how genetic inhibition of fatty acid oxidation regulates Fsp27/CIDEC expression during fasting in the liver.
Snippet: Adenovirus generation. For the generation of adenovirus encoding shRNA Hmgcs2, the sequence against mouse Hmgcs2 GGCTTCTGTTCAGTCCAGGAGGACATCAA encoded in the pGFP-V-RS-shRNA vector (Origene, GI579478) was first tested in vitro (data not shown).
Human HMGCS2 regulates mitochondrial fatty acid oxidation and FGF21 expression in HepG2 cell line
Vilà-Brau, De Sousa-Coelho, Mayordomo et al
J. Biol. Chem. (2011) 286 (23), 20423-30 DOI: 10.1074/jbc.M111.235044
Cited by 16
AI Summary: OriGene contributed to this study by providing retroviral-based plasmids containing shRNA to human HMGCS2, which were used to down-regulate HMGCS2 expression and assess its role in fatty acid oxidation and FGF21 expression in HepG2 cells.
Snippet: Interestingly, PPARα-mediated induction was abolished when HMGCS2 expression was down-regulated by RNAi. ... HepG2 shRNA Stable Cell Lines. Several retroviral-based plasmids containing a shRNA to human HMGCS2 were purchased from Origene (Rockville, MD).
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products