OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

PTPN22 Human shRNA Plasmid Kit (Locus ID 26191)

Be the first to review this product
SKU
TR310061
PTPN22 - Human, 4 unique 29mer shRNA constructs in retroviral untagged vector, 5µg of each construct provided
  $883.00
In Stock*

Frequently Bought Together (2)

TA810177 PTPN22 mouse monoclonal antibody,clone OTI6B1
100 ul
$447.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "PTPN22 or NM_001193431"

Specifications
Specifications
Product Data
Locus ID 26191
Synonyms LYP; LYP1; LYP2; PEP; PTPN8; PTPN22.5; PTPN22.6
Vector pRS
E. coli Selection Ampicillin
Mammalian Cell Selection Puromycin
Format Retroviral plasmids
Components PTPN22 - Human, 4 unique 29mer shRNA constructs in retroviral untagged vector(Gene ID = 26191). 5µg purified plasmid DNA per construct
29-mer scrambled shRNA cassette in pRS Vector, TR30012, included for free.
RefSeq NM_001193431, NM_001308297, NM_012411, NM_015967, NM_012411.1, NM_012411.2, NM_012411.3, NM_012411.4, NM_012411.5, NM_015967.1, NM_015967.2, NM_015967.3, NM_015967.4, NM_015967.5, NM_015967.6, NM_001193431.1, NM_001193431.2, BC017785, BC071670, NM_015967.7
UniProt ID Q9Y2R2
Summary This gene encodes of member of the non-receptor class 4 subfamily of the protein-tyrosine phosphatase family. The encoded protein is a lymphoid-specific intracellular phosphatase that associates with the molecular adapter protein CBL and may be involved in regulating CBL function in the T-cell receptor signaling pathway. Mutations in this gene may be associated with a range of autoimmune disorders including Type 1 Diabetes, rheumatoid arthritis, systemic lupus erythematosus and Graves' disease. Alternatively spliced transcript variants encoding distinct isoforms have been described. provided by RefSeq, Mar 2009
shRNA Design These shRNA constructs were designed against multiple splice variants at this gene locus. To be certain that your variant of interest is targeted, please contact techsupport@origene.com. If you need a special design or shRNA sequence, please utilize our custom shRNA service.
Storage Store at -20°C
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Melanoma Leverages Innate Immune IRAK-M Signaling to Limit Metastasis Through PTPN22-Induced Signaling Repression
Geng, Chen, Sanchez et al
Cancer Lett (2025)
AI Summary: OriGene’s PTPN22 human shRNA plasmid kit (TR310061) and scrambled shRNA control (TR30012) were used in this study to knock down PTPN22 expression, enabling the authors to demonstrate the essential role of PTPN22 in mediating IRAK-M’s suppression of melanoma metastasis.
Snippet: … The PTPN22 PCR product was digested with BamHI and XhoI and ligated into the digested pCDH-EF1α-MCS-IRES-GFP, and then confirmed by DNA sequencing. We used PTPN22 human shRNA plasmid kit (TR310061), from OriGene, which includes constructs A to D in retroviral vector pRS along with a 29-mer scrambled shRNA cassette in the same Vector (TR30012) to knockdown PTPN22 expression. The shRNA sequences are TR310061 A: CGTTGTTACCAAGAGGATGACAGTGT
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products