OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Stromal interaction molecule 1 (STIM1) Human shRNA Plasmid Kit (Locus ID 6786)

Be the first to review this product
SKU
TR309049
STIM1 - Human, 4 unique 29mer shRNA constructs in retroviral untagged vector, 5µg of each construct provided
  $883.00
In Stock*

Frequently Bought Together (2)

TA306421 Rabbit Polyclonal STIM1 Antibody
100 ug
$640.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Stromal interaction molecule 1 or NM_001277961"

Specifications
Specifications
Product Data
Locus ID 6786
Synonyms D11S4896E; GOK; IMD10; STRMK; TAM; TAM1
Vector pRS
E. coli Selection Ampicillin
Mammalian Cell Selection Puromycin
Format Retroviral plasmids
Components STIM1 - Human, 4 unique 29mer shRNA constructs in retroviral untagged vector(Gene ID = 6786). 5µg purified plasmid DNA per construct
29-mer scrambled shRNA cassette in pRS Vector, TR30012, included for free.
RefSeq NM_001277961, NM_001277962, NM_003156, NM_003156.1, NM_003156.2, NM_003156.3, NM_001277962.1, NM_001277961.1, BC021300, BC019905, BM127091, NM_001277961.3, NM_001277962.2, NM_003156.4
UniProt ID Q13586
Summary This gene encodes a type 1 transmembrane protein that mediates Ca2+ influx after depletion of intracellular Ca2+ stores by gating of store-operated Ca2+ influx channels (SOCs). It is one of several genes located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocrotical carcinoma, and lung, ovarian, and breast cancer. This gene may play a role in malignancies and disease that involve this region, as well as early hematopoiesis, by mediating attachment to stromal cells. Mutations in this gene are associated with fatal classic Kaposi sarcoma, immunodeficiency due to defects in store-operated calcium entry (SOCE) in fibroblasts, ectodermal dysplasia and tubular aggregate myopathy. This gene is oriented in a head-to-tail configuration with the ribonucleotide reductase 1 gene (RRM1), with the 3' end of this gene situated 1.6 kb from the 5' end of the RRM1 gene. Alternative splicing of this gene results in multiple transcript variants. provided by RefSeq, May 2013
shRNA Design These shRNA constructs were designed against multiple splice variants at this gene locus. To be certain that your variant of interest is targeted, please contact techsupport@origene.com. If you need a special design or shRNA sequence, please utilize our custom shRNA service.
Storage Store at -20°C
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

JBC Papers in Press. Published on December 22, 2014 as Manuscript M114. 601856
Shalygin, Skopin, Kalinina et al
The Journal of Biological Chemistry (2014)
Snippet: For STIM knockdown, the cells were transiently cotransfected with a mixture of STIM shRNA plasmid (STIM1 shRNA sequence CTGAGCAGAGTCTGCA TGACCTTCAGGAA from Origene and STIM2 shRNA sequence CCGGGCTCAATTTCAGACACTCATTCTCGA ... Cite SaveSaving
STIM1 and STIM2 Proteins Differently Regulate Endogenous Store-operated Channels in HEK293 Cells
Shalygin, Skopin, Kalinina et al
J. Biol. Chem. (2014)
AI Summary: OriGene’s STIM1 shRNA (sequence CTGAGCAGAGTCTGCATGACCTTCAGGAA) and STIM2 shRNA (sequence CCGGGCTCAATTTCAGACACTCATTCTCGA) plasmids were used for targeted knockdown of STIM1 and STIM2 proteins in HEK293 cells, enabling the study of their distinct roles in regulating endogenous store-operated channels.
Snippet: For STIM knockdown, the cells were transiently cotransfected with a mixture of STIM shRNA plasmid (STIM1 shRNA sequence CTGAGCAGAGTCTGCA TGACCTTCAGGAA from Origene and STIM2 shRNA sequence CCGGGCTCAATTTCAGACACTCATTCTCGA ... Cite SaveSaving
Lipid rafts couple store-operated Ca2+ entry to constitutive activation of PKB/Akt in a Ca2+/calmodulin-, Src- and PP2A-mediated pathway and promote melanoma tumor growth
Fedida-Metula, Feldman, Koshelev et al
Carcinogenesis (2012) 33 (4), 740-50 DOI: 10.1093/carcin/bgs021
Cited by 83
AI Summary: In this study, OriGene’s Stim1 shRNA (OriGene, catalog # TL502431) was used to diminish store-operated Ca2+ entry, enabling the authors to demonstrate that disruption of Stim1-mediated calcium signaling within lipid rafts impairs PKB/Akt activation and melanoma tumor growth.
Evidence for STIM1- and Orai1-dependent store-operated calcium influx through ICRAC in vascular smooth muscle cells: role in proliferation and migration
Potier, Gonzalez, Motiani et al
FASEB J (2009) 23 (8), 2425-37 DOI: 10.1096/fj.09-131128
Cited by 264
AI Summary: In this study, OriGene’s STIM1 and Orai1 siRNA/shRNA products were used to knock down gene expression, demonstrating that these proteins are essential for store-operated calcium entry and related vascular smooth muscle cell functions.
FigureFigureFigure
Store-operated cyclic AMP signalling mediated by STIM1
Lefkimmiatis, Srikanthan, Maiellaro et al
Nat Cell Biol (2009) 11 (4), 433-42 DOI: 10.1038/ncb1850
Cited by 156
AI Summary: OriGene products contributed to this study by providing the human STIM1 cDNA clone (OriGene, SC119274), which was used to investigate the role of STIM1 in store-operated cAMP signalling.
Canonical transient receptor potential 5 channel in conjunction with Orai1 and STIM1 allows Sr2+ entry, optimal influx of Ca2+, and degranulation in a rat mast cell line
Ma, Peng, Hiragun et al
J Immunol (2008) 180 (4), 2233-9 DOI: 10.4049/jimmunol.180.4.2233
Cited by 95
AI Summary: OriGene products, specifically TRPC5, Orai1, and STIM1 plasmids and inhibitory RNAs, were used in this study to manipulate gene expression in rat mast cells, enabling the authors to demonstrate the roles of these proteins in mediating Ca2+ and Sr2+ entry and mast cell degranulation.
FigureFigure
Showing 1-6 of 6 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products