OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

MIR16 Rat MicroRNA Expression Plasmid (MI0000844)

Be the first to review this product
SKU
SC403169
Expression Plasmid of Rat microRNA MIR16
  $424.00
3 Weeks*

Frequently Bought Together (1)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00

Other products for "MIR16 or MI0000844"

Specifications
Specifications
Product Data
Species Rat
Vector pCMV-MIR
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequences
Precursor: CAUACUUGUUCCGCUCUAGCAGCACGUAAAUAUUGGCGUAGUGAAAUAAAUAUUAAACACCAAUAUUAUUGUGCUGCUUUAGUGUGACAGGGAUA:
Mature Sequence: UAGCAGCACGUAAAUAUUGGCG:
Full Insert
>MI0000844 GTTGGAAATCTTCTTAGAAGCCATGGGATTGACTTAGACCATAATCGATTTTTAATCTTGCAGGTACGTT
TAAAAATTCTTCCAAAGTTTTTGGGTTTTGGTTTGTAATAAAGCTTCAAAGGGCGTTGTTCTGTTTGGTG
AATCCTGTCTTTTGGAACCTTAAAGTACTGTAGCAGCACATCATGGTTTACATACTACAGTCAAGATGCG
AATCATTATTTGCTGCTCTAGAAATTTAAGGAAATTCATTCAAGACTATATTGTTATCATCACACTTGTA
TTATTATGTTTGGACATTGACATACTTGTTCCGCTCTAGCAGCACGTAAATATTGGCGTAGTGAAATAAA
TATTAAACACCAATATTATTGTGCTGCTTTAGTGTGACAGGGATATAGCAACTCCCTTTAAGATAAAAGT
GTTTCATAGTCCCTTTTGTTTATTGTCACTTTTCTAACATAAAAACCATATATTTGATATTACAGCAAAT
TTTCCTGGGTACCTAATATAATATTTTTATATTTCAATAAAGGTTTACTTTGCGTGGGTTTAATTTGTAC
ACAATGGCCTAATTTCTTAAACCAATACTATTAGTATCAATTCTTAGGGAAGTCCTTTTTAGAAGTATAA
AAAAAATTAGGTTCCTGGTATTTTCATTATTATTATTTCTTTTATTTTATTGTTTCTTCCTTTTT
Components 1 x 10 ug vial miRNA plasmid lyophilized in a 2-D bar-coded Matrix tube
Also Contains Both mature and minor (star) miRNA can be over expressed from the construct.
OTI Disclaimer All miRNA clones were sequenced to ensure that the pre-mir sequences match reference sequence in miRBase. The flanking sequence of a miRNA clone may differ from the NCBI reference with respect to biological polymorphisms. This should not affect the function of the mature miRNA.
Shipping Ambient
Reference Data
RefSeq MI0000844
Synonyms rno-mir-16
Locus ID 100313997
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

MicroRNA-16 directly binds to DEC2 and inactivates the TLR4 signaling pathway to inhibit lupus nephritis-induced kidney tissue hyperplasia and mesangial cell proliferation
Qi, Cao, Liu
Int. Immunopharmacol. (2020) 88, 106859 DOI: 10.1016/j.intimp.2020.106859
Cited by 26
AI Summary: OriGene contributed agomiR and antagomiR vectors of miR-16, which were used to modulate miR-16 levels in mice and investigate its role in lupus nephritis in this study.
Snippet: group. From week 32, the mice were given either agomiR or antagomiR vectors of miR-16 (all purchased from OriGene Technologies, Rockville, MD, USA) through the tail vein once a week till the end point of the experiment (Fig
microRNA-16 Is Downregulated During Insulin Resistance and Controls Skeletal Muscle Protein Accretion
Lee, Brown, Rosa et al
J. Cell. Biochem. (2015)
Cited by 62
AI Summary: OriGene products contributed to this study by providing the plasmids pCMV-miR (Cat# PCMVMIR) and pCMV-miR16 (Cat# SC400199), which were used to manipulate miR-16 expression in skeletal muscle cells to investigate its role in protein synthesis and turnover during insulin resistance.
Snippet: Plasmids encoding empty vector (pCMV-miR, Sku:PCMVMIR;pCMV) and miR-16 (pCMV-miR16, Sku:SC400199;miR-16;Origene, Rockville, MD, USA) were transformed into DH5-α Escherichia coli [Froger and Hall, 2007]. Plasmid DNA was amplified and isolated ... Cite SaveSaving
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products