OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Mir378 Mouse MicroRNA Expression Plasmid (MI0000795)

Be the first to review this product
SKU
SC401025
Expression plasmid for mouse microRNA Mir378
  $424.00
In Stock*

Frequently Bought Together (1)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00

Other products for "Mir378 or MI0000795"

Specifications
Specifications
Product Data
Species Mouse
Vector pCMV-MIR
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequences
Precursor: AGGGCUCCUGACUCCAGGUCCUGUGUGUUACCUCGAAAUAGCACUGGACUUGGAGUCAGAAGGCCU:
Mature Sequence: CUCCUGACUCCAGGUCCUGUGU:
Full Insert
>MI0000795 CAGTTGTCAGCAGAAGCAGTGCAGTGAAAGTTAATTTGGGACGTTTGTTCCCCCCCACCCCACCCCCTTT
TAACTTAATCACGTGATAGGCCGAAGATCTCCGGGTGATCTTTGCCGGGCCAACTTGGGAAATGTAATTG
ATACCAGGAGCTTTGCAGCCGCCCCTAGAAGGCTCAGAGCTGAGCGGGAATGGGCGGGGCAGCCCGCCGC
CTCATTTTACAGTTGGGGAAGAGGCTGCGAGGGGTGAACTGCTTGTCCACGACCACTCAGCCAGGGGGTG
ACAGAGCCACCCAGGGCTCCTGACTCCAGGTCCTGTGTGTTACCTCGAAATAGCACTGGACTTGGAGTCA
GAAGGCCTGAGTGGAGTCACCTTCCCCGCTCTCTGGCTGGGTGATCCTGGAGCAAGCCATTTTAACTCTC
CAGCCGTGTTTCTCCATCTGTCCAATGGGGCCGGTGTGGTGCTGACGGAGAAGCCAGAGGCCTGCTGGTG
GGGGTGAGCCTGTGTTTGCATGTGAGCTGTCTGGCTGTCCAGCTTCTTCCCCACAGCCCTTCCCAGACCC
TCCCCTCCCCCCAGCTCTCCCCCTCGGGAGGGTTGGGGAAAGTGGATTGTCTCTGTTCCCCCAAAGAGTT
CTTCTTGTCTTTGGTGGCTAACCCAG
Components 1 x 10 ug vial miRNA plasmid lyophilized in a 2-D bar-coded Matrix tube
Also Contains Both mature and minor (star) miRNA can be over expressed from the construct.
OTI Disclaimer All miRNA clones were sequenced to ensure that the pre-mir sequences match reference sequence in miRBase. The flanking sequence of a miRNA clone may differ from the NCBI reference with respect to biological polymorphisms. This should not affect the function of the mature miRNA.
Shipping Ambient
Reference Data
RefSeq MI0000795
Synonyms mmu-mir-378
Locus ID 723889
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

MicroRNA-378 protects against intestinal ischemia/reperfusion injury via a mechanism involving the inhibition of intestinal mucosal cell apoptosis
Li, Wen, Yao et al
Cell Death Dis (2017) 8 (10), e3127 DOI: 10.1038/cddis.2017.508
AI Summary: In this study, the genomic sequence of miR-378 was obtained from OriGene Technologies to generate transgenic mice for investigating the protective role of miR-378 against intestinal ischemia/reperfusion injury.
Snippet: (Cyagen Biosciences, Guangzhou, China) mice were produced by pronuclear injection. Briefly, we first acquired the genomic sequence of miR-378 from the Origene company. (OriGene Technologies, Rockville, MD, USA) website, then intercepted Villin genes. ...;... (Cyagen Biosciences, Guangzhou, China) mice were produced by pronuclear injection. Briefly, we first acquired the genomic sequence of miR-378...
Exploring the mitochondrial microRNA import pathway through Polynucleotide Phosphorylase (PNPase)
Shepherd, Hathaway, Pinti et al
J. Mol. Cell. Cardiol. (2017) 110, 15-25 DOI: 10.1016/j.yjmcc.2017.06.012
AI Summary: OriGene’s pre-miRNA-378 miRNA expression plasmid (pCMV-MIRNA, Product # sc401025) was used to generate HL-1 cardiomyocyte cell lines stably overexpressing miRNA-378, enabling the study of mitochondrial miRNA import and its effects on cellular bioenergetics in diabetes.
Snippet: 378 HL-1 overexpressing cell line (HL-1-378) generated by our laboratory was also used as previously described [50];stably overexpressing miRNA-378 through a pre-miRNA-378 miRNA expression plasmid (pCMV-MIRNA) (Product # sc401025;Origene, ... All 3 versions Cite SaveSaving
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products