OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Mir150 Mouse MicroRNA Expression Plasmid (MI0000172)

Be the first to review this product
SKU
SC400788
Expression plasmid for mouse microRNA Mir150
  $424.00
In Stock*

Frequently Bought Together (1)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00

Other products for "Mir150 or MI0000172"

Specifications
Specifications
Product Data
Species Mouse
Vector pCMV-MIR
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequences
Precursor: CCCUGUCUCCCAACCCUUGUACCAGUGCUGUGCCUCAGACCCUGGUACAGGCCUGGGGGAUAGGG:
Mature Sequence: UCUCCCAACCCUUGUACCAGUG:
Full Insert
>MI0000172 CACACCTCTCAACAATTGGCTTTAGATTCCTCAGGGTCCCTGTCCCCTGTAGCTCTGGGGCTCGCCCCTC
CTCTGCTTAGTGGCTCTACTCCTGGGTGGCTGGCAGGCACCCAGCTTGGGCGGTGCCCCTCCTGACCTGT
CCCTGCCCCTTCCTGCTCGCTTTGATGCAGGCCCACTTCCTTTGACAGGAACCCCCTCCCTCAGCAGCCT
GGTTAAATGCAGAAGGCCGTGGTGAAGCAGTGCTTTCCGCAGCATCTCTTGCAGGCAGAGGACTCTTCTC
AATGCCCTGTCTCCCAACCCTTGTACCAGTGCTGTGCCTCAGACCCTGGTACAGGCCTGGGGGATAGGGA
CTTGGGAACCCCAGCAGCAACAACTCCAGCTTCTCCCTCCAGCCAAGGGACTTTTCCCCAGGTTTGGCCT
ACATACAGGGGATGCCTTGGGTCCCTTCCTAAGTGGGTGTTCCCATCACTCCAACATCCATCCTGGACAA
CCTGGGGCCTTCTTCTCATCTCACTGCTGAAGGGTTCCTGTCCTTGTTGGCCCTGTCCCTGGACATAAGC
CAGAGGGGAGGCAGTGGCTACAGGGGTTCAAGCAGATCATGATACTCAAGTTGGAGAACTTGCCCCTTCC
TAGGTGTCTTCACCTG
Components 1 x 10 ug vial miRNA plasmid lyophilized in a 2-D bar-coded Matrix tube
Also Contains Both mature and minor (star) miRNA can be over expressed from the construct.
OTI Disclaimer All miRNA clones were sequenced to ensure that the pre-mir sequences match reference sequence in miRBase. The flanking sequence of a miRNA clone may differ from the NCBI reference with respect to biological polymorphisms. This should not affect the function of the mature miRNA.
Shipping Ambient
Reference Data
RefSeq MI0000172
Synonyms Mirn150 mmu-mir-150
Locus ID 387168
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

MicroRNA-150 deletion in mice protects kidney from myocardial infarction induced acute kidney injury
Ranganathan, Jayakumar, Tang et al
Am. J. Physiol. Renal Physiol. (2015)
Cited by 67
AI Summary: OriGene’s CMV expression plasmid for miR-150 (catalog number SC400788) was used for gain-of-function studies to investigate the role of miR-150 in acute kidney injury in this paper.
Snippet: Cedarlane and maintained according to the company's recommendation. For gain-of- 192 function studies, we transfected CMV expression plasmids for miR-150 (Origene, 193 SC400788) or miR-150 mimics (Life Technologies, MC10070). All in vitro assays were 194 ... Cite SaveSaving
MicroRNA-150 protects the mouse heart from ischaemic injury by regulating cell death
Tang, Wang, Park et al
Cardiovasc Res (2015) 106 (3), 387-97 DOI: 10.1093/cvr/cvv121
Cited by 122
AI Summary: In this study, OriGene products—including the mouse Egr2 and P2rx7 cDNA clones—were used to investigate the direct regulatory effects of miR-150 on pro-apoptotic genes in cardiomyocytes, helping to elucidate the molecular mechanisms by which miR-150 protects the heart from ischaemic injury.
Rbfox3 controls the biogenesis of a subset of microRNAs
Kim, Yang, Zhu et al
Nat. Struct. Mol. Biol. (2014)
Cited by 51
AI Summary: OriGene’s MicroRNA Expression Plasmids were used as DNA templates to generate pri-miRNA sequences (pri-miR-15a, pri-miR-485, pri-miR-214, and pri-miR-150) for in vitro analyses investigating Rbfox3’s role in microRNA biogenesis.
Snippet: DNA templates containing the T7 promoter and encoding an approximately 200-nt region of pri-miRNAs were generated by PCR from MicroRNA Expression Plasmids (OriGene) with the following primer sets: 5′-TTG TAA TAC GAC TCA CTA TAG GGA AGC CTT TTC TGT AAA TTA C-3′ and 5′-GCT ATC ATA GGA GCT ATG AAT AAA AAG-3′ for ​pri-miR-15a;5′-TTG TAA TAC GAC TCA CTA TAG GGA GAG AGT CGA TGT GTT CTT C-3′ and 5′-ACA T...
Showing 1-3 of 3 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products