OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

MIR9-1 Human MicroRNA Expression Plasmid (MI0000466)

Be the first to review this product
SKU
SC400676
Expression plasmid for human microRNA MIR9-1
  $424.00
In Stock*

Frequently Bought Together (1)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00

Other products for "MIR9-1 or MI0000466"

Specifications
Specifications
Product Data
Species Human
Vector pCMV-MIR
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequences
Precursor: CGGGGUUGGUUGUUAUCUUUGGUUAUCUAGCUGUAUGAGUGGUGUGGAGUCUUCAUAAAGCUAGAUAACCGAAAGUAAAAAUAACCCCA:
Mature Sequence: UCUUUGGUUAUCUAGCUGUAUGA:
Full Insert
>MI0000466 GGGCACCAGAAACTTTTTGGGTCTGGATCGGGGTCAACTCCCCGACTTCGACGCCACGGGTCATCGCGTC
CTTTCCACGCCTTTTTCGGTCTCTGTCGTGTCTGTATCTCCGTGTCTGAGGTTTTTGTTGTTGTTTTGTC
TCGGACTTCATTTCTCTCTTCACCCTCCCCCTCAACTCCACTCGTGTCCCTTCCCTCCTACTCCCGCTGA
CGGGCGACCGGGAAGCTGCGGAGGTGCTGGCGGCGGCGGCGGCCGGGAGGCTGCGTGGAAGAGGCGGCGA
CAGCAGCCAGGAGGCGGGGTTGGTTGTTATCTTTGGTTATCTAGCTGTATGAGTGGTGTGGAGTCTTCAT
AAAGCTAGATAACCGAAAGTAAAAATAACCCCATACACTGCGCAGAGGGGCCCGGGGAAAGCCGGCCTCA
CGGGCGGGAGGGAGAGGCTTGAGCGAGGGGCTAGAGCCGCGAGGACTGACCAGCACCAGAGGATACAAGA
GGAGGAGAGAGACCTCACTGGTTCGGGCGACATTTCACCCCCCCAGCACCCCAGTCGGCACAGGTAGGAG
TCACAGTCCCATTTCACTTCAGCCAGGTGCCATATTTTTCCCCCAGCAGAGTTGAGGGGGAGCAAGGAAG
CCTCATTGTGGTGCCCTCTGGTGGTC
Components 1 x 10 ug vial miRNA plasmid lyophilized in a 2-D bar-coded Matrix tube
Also Contains Both mature and minor (star) miRNA can be over expressed from the construct.
OTI Disclaimer All miRNA clones were sequenced to ensure that the pre-mir sequences match reference sequence in miRBase. The flanking sequence of a miRNA clone may differ from the NCBI reference with respect to biological polymorphisms. This should not affect the function of the mature miRNA.
Shipping Ambient
Reference Data
RefSeq MI0000466
Synonyms MIRN9-1 miRNA9-1 hsa-mir-9-1
Locus ID 407046
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Identification of direct target genes of miR-7, miR-9, miR-96, and miR-182 in the human breast cancer cell lines MCF-7 and MDA-MB-231
Moazzeni, Najafi, Khani
Mol. Cell. Probes (2017)
AI Summary: In this study, OriGene's pCMV-MIR miRNA expression vectors for miR-7 (Cat # SC400648) and miR-9 (Cat # SC400676) were used to overexpress these microRNAs in breast cancer cell lines, enabling the identification of their direct target genes and elucidation of their roles in tumor suppression.
Snippet: Four microRNAs, used in this research, were cloned into the pCMV-MIR vectors (OriGene;miR-7: Cat # SC400648 and miR-9: Cat # SC400676) and the un-cloned miRNAs (Ambion;miR-96: PM10422 and miR-182: PM12369) (kindly provided by Dr. Elahe Elahi). ... All 2 versions Cite SaveSaving
Her-2 expression regulated by downregulation of miR-9 and which affects chemotherapeutic effect in breast cancer
Sun, Sun, Liu et al
Cancer Gene Ther. (2017)
AI Summary: OriGene products contributed to this study by providing the pCMV-MIR-9 (miR-9) and pCMV-MIR vector (EV) plasmids, which were used to stably transfect MCF-7 breast cancer cells and investigate the effects of miR-9 expression on Her-2 regulation and chemotherapeutic response.
Snippet: MCF-7 cells, stably transfected with pCMV-MIR-9 (miR-9) and pCMV-MIR vector (EV) (Beijing OriGene Technologies,Inc, Beijing, China), were seeded at 500 and 1000 cells per well, respectively, into 6-well dishes (Corning Costar, Cambridge, MA, USA). ... All 3 versions Cite SaveSaving
High expression of miR-9 in CD133 glioblastoma cells in chemoresistance to temozolomide
Munoz, Rodriguez-Cruz
Journal of Cancer Stem Cell Research (2015) 2015 (3)
Snippet: no other options. SUPPLEMENTAL INFORMATION U87 were stably transfected with pCMV-MIR-9 or control vector (Origene, Rockville, MD). RNA was isolated and then analyzed by real-time PCR for MGMT. The normalized ... Cite SaveSaving
Showing 1-3 of 3 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products