OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

MIR519A2 Human MicroRNA Expression Plasmid (MI0003182)

Be the first to review this product
SKU
SC400468
Expression plasmid for human microRNA MIR519A2
  $424.00
In Stock*

Frequently Bought Together (1)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00

Other products for "MIR519A2 or MI0003182"

Specifications
Specifications
Product Data
Species Human
Vector pCMV-MIR
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequences
Precursor: UCUCAGGCUGUGUCCCUCUACAGGGAAGCGCUUUCUGUUGUCUGAAAGAAAGGAAAGUGCAUCCUUUUAGAGUGUUACUGUUUGAGA:
Mature Sequence: AAAGUGCAUCCUUUUAGAGUGU:
Full Insert
>MI0003182 TCCAGCCTAATCCTCTTGTGCAAATATAATATATATCTAGTAGGCATTGCTTTTTCTTTCTGGAGACAAA
ACACAGGAGGATTGCCCCTTGATGAACAGGACTAACCTGCTGATTCTTTGAAGCAAGGAACTGGAAATGG
TCCTTTTAGGGATTTATGCTCTGGATTCCAGAAAACACGCAAACAGGGCCAATAAATGCATCTTTATTTT
TGTGTCCATTTTGACCTGGTCAAGGAAGATTCCAACAAAAAATCCACAGTGCCGGAGCAAGAAGATCTCA
GGCTGTGTCCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAGGAAAGTGCATCCTTTTAGAGTGT
TACTGTTTGAGAAAAGCAACGTTGAAGTTGATGCTGATTTTGGTAATACATTTGCAGAGCATGCTTATCA
TCAGACTTGGATGATGTTGGGTTCTGTTTTTGCTTTGTTTTTTTTTCCAAGACAGTGTGTTTGTTGCCCA
GGCTGGAGTGCGGTGGTACTTCCCACCTAGATCTCTTGGGCTCAAGAGGTCTTTTTTTATTTTTCTTTCT
CAAGAGAGAGTCTGGTGGTGACACCCAGGCTGGAGTGCAGTGGTGCATTATCAGCTCACTGCAGCCTTCC
CCTCCCCGGTTCAAGTGATTCTTTCACCTC
Components 1 x 10 ug vial miRNA plasmid lyophilized in a 2-D bar-coded Matrix tube
Also Contains Both mature and minor (star) miRNA can be over expressed from the construct.
OTI Disclaimer All miRNA clones were sequenced to ensure that the pre-mir sequences match reference sequence in miRBase. The flanking sequence of a miRNA clone may differ from the NCBI reference with respect to biological polymorphisms. This should not affect the function of the mature miRNA.
Shipping Ambient
Reference Data
RefSeq MI0003182
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

miR-519a enhances chemosensitivity and promotes autophagy in glioblastoma by targeting STAT3/Bcl2 signaling pathway
Li, Chen, Li et al
J Hematol Oncol (2018) 11 (1), 70 DOI: 10.1186/s13045-018-0618-0
AI Summary: OriGene contributed to this study by providing the miRNA overexpression vector pCMV-MIR519A (MI0003182) and the empty vector control, which were used to manipulate miR-519a levels in glioblastoma cells to investigate its effects on chemosensitivity and autophagy.
Snippet: The oligonucleotide sequences were listed in Table S1 (Additional file 1: Table S1). The miRNA overexpression vector pCMV-MIR519A (MI0003182) and the empty vector control were obtained from OriGene (Rockville, MD, USA) Cached
MicroRNA-519a-3p mediates apoptosis resistance in breast cancer cells and their escape from recognition by natural killer cells
Breunig, Pahl, Küblbeck et al
Cell Death Dis (2017) 8 (8), e2973 DOI: 10.1038/cddis.2017.364
AI Summary: OriGene’s pCMV-MIR vector MIR519A2 (MI0003182) and empty vector control were used to generate stable breast cancer cell lines for studying the role of miR-519a-3p in apoptosis resistance and immune evasion in this paper.
Snippet: were used at a final concentration of 30 or 50 nM. pCMV-MIR vector MIR519A2. (MI0003182) as well as empty vector control were obtained from OriGene. (Rockville, MD, USA) and stable MDA-MB-231 cells were generated using G418. (Thermo Fisher Scientific). ... All 2 versions Cite SaveSaving
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products