OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

MIR375 Human MicroRNA Expression Plasmid (MI0000783)

Be the first to review this product
SKU
SC400372
Expression plasmid for human microRNA MIR375
  $424.00
In Stock*

Frequently Bought Together (1)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00

Other products for "MIR375 or MI0000783"

Specifications
Specifications
Product Data
Species Human
Vector pCMV-MIR
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequences
Precursor: CCCCGCGACGAGCCCCUCGCACAAACCGGACCUGAGCGUUUUGUUCGUUCGGCUCGCGUGAGGC:
Mature Sequence: UUUGUUCGUUCGGCUCGCGUGA:
Full Insert
>MI0000783 CGGGACAAGCTCCAAGGCGTGGGCTGGGGACGAAGCCAAGCTAGGCTGGGCCGGGCGGAGGGGCCAGGAA
AGCCGGGCGGAGGGTGGCTGGGAAAGGAGGGGCGGGCCAGGTGCGCACCTGCGGTGGCCGCCGCGGCCGC
CGACGTGTCAGCCGCAGATGCGTTCAGGTGAGGGCGGAGGCTAGCGGGGCGCTGTGCAGCACTGAGCTCG
CGGAAGACCAGGACCAGGAGATCACCGAGGGCGACCGCCAGGCCCCGGGCCCTCCGCTCCCGCCCCGCGA
CGAGCCCCTCGCACAAACCGGACCTGAGCGTTTTGTTCGTTCGGCTCGCGTGAGGCAGGGGCGGCCTCTC
AGCACCAGCCCGGGGGCCGGCCTGATCGCCACGCAGGCACCTGCCGCCGCCACCGCCACCGCCATCTCAA
CCGTACGGGTGGGAGAGGCTGTGCGCCGCTCCAGGGGAGATCCGGCTCCCATCCGGCCCCACCCGCCCTG
CCTTGCCCTGCCCGCAGCTTCTGGGCTGCCAGGCTCCATTCTGCGTCGTAATACGGGCTGAGCCGGCTCC
AGCGGGTGGCGAAGGGGGCCGTGGCCCAGAACAGAAACCCTTCTGGAGGTGGAAA
Components 1 x 10 ug vial miRNA plasmid lyophilized in a 2-D bar-coded Matrix tube
Also Contains Both mature and minor (star) miRNA can be over expressed from the construct.
OTI Disclaimer All miRNA clones were sequenced to ensure that the pre-mir sequences match reference sequence in miRBase. The flanking sequence of a miRNA clone may differ from the NCBI reference with respect to biological polymorphisms. This should not affect the function of the mature miRNA.
Shipping Ambient
Reference Data
RefSeq MI0000783
Synonyms MIRN375 miRNA375 hsa-mir-375
Locus ID 494324
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

miR-375- and miR-1-Regulated Coxsackievirus B3 Has No Pancreas and Heart Toxicity But Strong Antitumor Efficiency in Colorectal Carcinomas
Hazini, Dieringer, Pryshliak et al
Hum Gene Ther (2021)
Cited by 28
AI Summary: OriGene products pCMV-miR-1, pCMV-miR-375, and pCMV-miR (GFP control) expression plasmids were used to transiently express specific microRNAs in HEK293T cells, enabling the authors to assess the microRNA-dependent attenuation of engineered Coxsackievirus B3 variants.
Snippet: percent confluent HEK293T cells were transfected with 800 ng miR expression plasmids;pCMV-miR-1 expressing the miR-1, pCMV-miR-375 expressing the miR-375, and pCMV-miR expressing only green fluorescent protein (GFP) as control (Origene Technologies;- percent confluent HEK293T cells were transfected with 800 ng miR expression plasmids
MiR-375-mediated suppression of engineered coxsackievirus B3 in pancreatic cells
Pryshliak, Hazini, Knoch et al
FEBS Lett. (2019)
AI Summary: OriGene products pCMV-MIR-375 and pCMV-MIR-216a plasmids, which express miR-375 and miR-216a respectively, were used in this study to investigate the effects of these microRNAs on the replication of engineered coxsackievirus B3 in pancreatic cells.
Snippet: The plasmids pCMV-MIR-375 expressing miR-375 and pCMV-MIR-216a expressing miR-216a were purchased from OriGene (OriGene Technologies Inc., Rockville, MD, USA). Viruses rCVB3.1, CVB3-375TS(3+), CVB3-375TS(3-), CVB3-375TS(5+), CVB3-375TS(5
Targeting MYCN IRES in MYCN-amplified neuroblastoma with miR-375 inhibits tumor growth and sensitizes tumor cells to radiation
Zhang, Liu, Yi et al
Mol Oncol (2015)
Cited by 19
AI Summary: OriGene contributed to this study by providing the pCMV-miR-375 expression plasmid (AM17100) and the control miRNA expression plasmid (AM17110), which were used to investigate the effects of miR-375 on MYCN-amplified neuroblastoma.
Snippet: The pCMV-miR-375 expression plasmid (AM17100) and control miRNA expression plasmid (AM17110) were purchased from Origene (Rockville, MD). The oligo miRNAs, including miR-375 (MC10327), miR-141 (MC10860) were purchased from Ambion (Austin, TX)
MicroRNA-375 inhibits tumour growth and metastasis in oesophageal squamous cell carcinoma through repressing insulin-like growth factor 1 receptor
Kong, Kwong, Chan et al
Gut (2012) 61 (1), 33-42 DOI: 10.1136/gutjnl-2011-300178
Cited by 238
AI Summary: OriGene’s miR-375 precursor was used in this study to experimentally increase miR-375 levels in oesophageal squamous cell carcinoma cells, enabling the authors to assess its tumour-suppressive effects and its role in regulating IGF1R expression.
Snippet: are transcribed by RNA polymerase II in hairpin structures and are processed by RNAse III Drosha into long pre-miRNA ... miR-375 precursor and miR-375 inhibitor were purchased from Origene (Rockville, Maryland, USA) and Dharmacon (Lafayette, Colorado, USA), respectively
Showing 1-4 of 4 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products