OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

MIR372 Human MicroRNA Expression Plasmid (MI0000780)

Be the first to review this product
SKU
SC400368
Expression plasmid for human microRNA MIR372
  $424.00
In Stock*

Frequently Bought Together (1)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00

Other products for "MIR372 or MI0000780"

Specifications
Specifications
Product Data
Species Human
Vector pCMV-MIR
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequences
Precursor: GUGGGCCUCAAAUGUGGAGCACUAUUCUGAUGUCCAAGUGGAAAGUGCUGCGACAUUUGAGCGUCAC:
Mature Sequence: AAAGUGCUGCGACAUUUGAGCGU:
Full Insert
>MI0000780 GCCTTGCCGCATCCCCTCAGCCTGTGGCACTCAAACTGTGGGGGCACTTTCTGCTCTCTGGTGAAAGTGC
CGCCATCTTTTGAGTGTTACCGCTTGAGAAGACTCAACCTGCGGAGAAGATACCATTTTGATTGGGTGAG
GGGGCGGGTAGCAGGATGGCCCTAGACCCTGCCTATGGCCGTTTCCTCGTGATATAAATTTCTTGGCCGG
GGCTCTTGCAGATGGAGCTGCTCACCCTGTGGGCCTCAAATGTGGAGCACTATTCTGATGTCCAAGTGGA
AAGTGCTGCGACATTTGAGCGTCACCGGTGACGCCCATATCAACGGATGCCGTGGAGCTCGGTCTTCTGC
AGGAACTAAAGAGCCTGTGGTTTCG
Components 1 x 10 ug vial miRNA plasmid lyophilized in a 2-D bar-coded Matrix tube
Also Contains MI0000779
Both mature and minor (star) miRNA can be over expressed from the construct.
OTI Disclaimer All miRNA clones were sequenced to ensure that the pre-mir sequences match reference sequence in miRBase. The flanking sequence of a miRNA clone may differ from the NCBI reference with respect to biological polymorphisms. This should not affect the function of the mature miRNA.
Shipping Ambient
Reference Data
RefSeq MI0000780
Synonyms MIRN372 hsa-mir-372
Locus ID 442917
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

HistoneH3 demethylase JMJD2A promotes growth of liver cancer cells through up-regulating miR372
An, Xu, Li et al
Oncotarget (2017) 8 (30), 49093-49109 DOI: 10.18632/oncotarget.17095
Snippet: pCMV6-AC- GFP, pCMV6-AC-GFP-JMJD2A, pGFP-V-RS, pGFP-V- RS-Pim1 were purchased from Origene (Rockville, MD, USA) and pcDNA3.1, pcDNA3.1-P21WAF1/Cip1 were purchased from Addgene (Cambridge, MA, USA)
FigureFigureFigure
SMAR1 binds to T(C/G) repeat and inhibits tumor progression by regulating miR-371-373 cluster
Mathai, Mittal, Alam et al
Sci Rep (2016) 6, 33779 DOI: 10.1038/srep33779
Cited by 16
AI Summary: OriGene’s pCMV-miR-371, pCMV-miR-372, and pCMV-miR-373 constructs were used in this study to overexpress the respective microRNAs, enabling the authors to investigate the regulatory role of SMAR1 on the miR-371-373 cluster in cancer progression.
Snippet: Cells were transfected with SMAR1 knockdown construct (sh1077) and harvested at 60 hours and protein extraction or RNA extraction was done. pCMV-miR-371, pCMV-miR-372 and pCMV-miR-373 constructs (Origene) were used for respective microRNA overexpressions as described above
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products