OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

MIR330 Human MicroRNA Expression Plasmid (MI0000803)

Be the first to review this product
SKU
SC400344
Expression plasmid for human microRNA MIR330
  $424.00
In Stock*

Frequently Bought Together (1)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00

Other products for "MIR330 or MI0000803"

Specifications
Specifications
Product Data
Species Human
Vector pCMV-MIR
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequences
Precursor: CUUUGGCGAUCACUGCCUCUCUGGGCCUGUGUCUUAGGCUCUGCAAGAUCAACCGAGCAAAGCACACGGCCUGCAGAGAGGCAGCGCUCUGCCC:
Mature Sequence: UCUCUGGGCCUGUGUCUUAGGC:
Full Insert
>MI0000803 CGCCATGAGTAGCTTTGGAGCTGGGTGAGACCCTTTCGCAGACCACCCCCCATCTCCTCTCCGCGCTCCC
GGGGCTTAGATCTCAGGTTTCACCCAACCCCTGGGACCCAGACCGGCGTGGGGACACGCCCCTTCCCTTA
AACTCTCCCCGTTTCTCCCTCTGCTTGACGTTTGGTGTGCTGGGGGAACTGCGGGTGGGGGGCGCTGGGG
AGCACCTTGCTGATTAGGAGGGAAGGGTCCTTGGTGACTCCCTTCTTCCAGGATCGCGTCCCTGCCACTT
CGTGCTGTGTGATCTTTGGCGATCACTGCCTCTCTGGGCCTGTGTCTTAGGCTCTGCAAGATCAACCGAG
CAAAGCACACGGCCTGCAGAGAGGCAGCGCTCTGCCCCTTACTCGGCCCCGTTTTCATCGGAGACCTCCG
GGGAGCGGTGGGGGTGGAGGAATGGTTTCTCCCCTTTTCTGAACTGAATACTAAGACCCTTTTTTTTTCT
TTGTCCTTTCCTGACAGCAAAACCAAAGAAGTTATCTTCAGTGTGGGTGAGTGGGGAGATGGGGAAGGGC
TCGGTGGAAGCTTGCTTGTTGGGGTGACAGGCTGGAGCCAGAGGTCAGGAGTCTTGGCTACTGGGTCTTT
GCCTCTCTGGCCTCAGTTTCCCTGCCTTTAA
Components 1 x 10 ug vial miRNA plasmid lyophilized in a 2-D bar-coded Matrix tube
Also Contains Both mature and minor (star) miRNA can be over expressed from the construct.
OTI Disclaimer All miRNA clones were sequenced to ensure that the pre-mir sequences match reference sequence in miRBase. The flanking sequence of a miRNA clone may differ from the NCBI reference with respect to biological polymorphisms. This should not affect the function of the mature miRNA.
Shipping Ambient
Reference Data
RefSeq MI0000803
Synonyms MIRN330 hsa-mir-330
Locus ID 442902
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Restoration of miR-330 expression suppresses lung cancer cell viability, proliferation, and migration
Mohammadi, Mansoori, Duijf et al
J. Cell. Physiol. (2020)
Cited by 20
AI Summary: OriGene’s PCMVmiR-330 plasmid was used to restore miR-330 expression in lung cancer cells, enabling the authors to demonstrate the tumor-suppressive effects of miR-330 in their study.
Snippet: … One well was cultured to be transfected by PCMVmiR‐330 (Origene) referred to as Vec + , and the other wells were cultured with empty PCMV cells as a negative control;- A549 cells were counted and 3 × 10 5 cells/well were seeded in a six‐well plate. One well was cultured to be transfected by PCMVmiR‐330 (Origene) referred to as Vec + , and the other wells were cultured with empty PCMV cells as a negative control
miR-330 suppresses EMT and induces apoptosis by downregulating HMGA2 in human colorectal cancer
Mansoori, Mohammadi, Naghizadeh et al
J. Cell. Physiol. (2019) 235 (2), 920-931 DOI: 10.1002/jcp.29007
AI Summary: OriGene contributed to this study by providing the empty pCMV vector and miR-330 pCMV vector, which were used to transfect colorectal cancer cells and investigate the effects of miR-330 on HMGA2 expression and cancer cell behavior.
Snippet: Before transfection, the cells seeded at a total number of 2 × 10 5 cells/well of the six‐well cell culture plate. The cells transfected by empty pCMV vector and miR‐330 pCMV vector were obtained from OriGene (Rockville, MD) at the 60% cell confluence;- Before transfection, the cells seeded at a total number of 2 × 10 5 cells/well of the six‐well cell culture plate. The cells transfected by emp...
MicroRNA-330 inhibits growth and migration of melanoma A375 cells: In vitro study
Sehati, Sadeghie, Mansoori et al
J. Cell. Biochem. (2019) 121 (1), 458-467 DOI: 10.1002/jcb.29211
AI Summary: OriGene's miR-330 expression plasmid (SKU: SC400344) was used to transfect melanoma A375 cells, enabling the study of miR-330's effects on cell growth and migration in this research.
Snippet: For this purpose, plasmid containing miR‐330 gene (SKU: SC400344;Origene) and glycerol, and 100 mM CaCl 2 were mixed within the ice bath and incubated for 30 minutes at 4°C. Next, microtubes were placed at 42°C in a water bath for 60 seconds to open the gaps of the;- For this purpose, plasmid containing miR‐330 gene (SKU: SC400344;Origene) and glycerol, and 100 mM CaCl 2 were mixed within the ice bath and incubated for 30 minutes at 4°C. …
MicroRNA-145 replacement effect on growth and migration inhibition in lung cancer cell line
Sadeghiyeh, Sehati, Mansoori et al
Biomed. Pharmacother. (2018) 111, 460-467 DOI: 10.1016/j.biopha.2018.12.094
AI Summary: In this study, the OriGene plasmid containing the miR-145 gene (SKU: SC400344) was used to transfect lung cancer cells, enabling the investigation of miR-145’s effects on cancer cell growth and migration.
Snippet: 42Q6852 K), and incubated at 37 °C in a humidified atmosphere with 5% CO 2 . 2.2. Transfection. A plasmid containing miR-145 gene (Origene, USA, SKU: SC400344) transfection was performed using jetPEI (Polyplus, France) according to the manufacturer's
miR-330 regulates colorectal cancer oncogenesis by targeting BACH1
Shirjang, Mansoori, Mohammadi et al
apb.tbzmed.ac.ir (2019)
Snippet: 60% confluence. In order to transfect the constructs into the cells, jetPRIME transfection reagent (Polyplus, France) was used to transfer of PCMV vector (Origene, USA) to the cells according to the company's instructions. The View as HTML
Showing 1-5 of 5 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products