OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

MIR30a Human MicroRNA Expression Plasmid (MI0000088)

Be the first to review this product
SKU
SC400322
Expression plasmid for human microRNA MIR30a
  $424.00
In Stock*

Frequently Bought Together (1)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00

Other products for "MIR30a or MI0000088"

Specifications
Specifications
Product Data
Species Human
Vector pCMV-MIR
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequences
Precursor: GCGACUGUAAACAUCCUCGACUGGAAGCUGUGAAGCCACAGAUGGGCUUUCAGUCGGAUGUUUGCAGCUGC:
Mature Sequence: UGUAAACAUCCUCGACUGGAAG:
Full Insert
>MI0000088 CACTTGCCTATTTACTTCTTGTGGCTAACAATAATGAATGAAACCATTTATATATGTTGTTTTAGTATAT
CACAAAATTTTATAGAAACTAGAAGCTCGGTGATGAATAATAGACATCCATGAGCCTTCTTATTTGTTTT
GAATTTGAGACATTTTCTAGAATATTGCTGTTTGAATGAGGCTTCAGTACTTTACAGAATCGTTGCCTGC
ACATCTTGGAAACACTTGCTGGGATTACTTCTTCAGGTTAACCCAACAGAAGGCTAAAGAAGGTATATTG
CTGTTGACAGTGAGCGACTGTAAACATCCTCGACTGGAAGCTGTGAAGCCACAGATGGGCTTTCAGTCGG
ATGTTTGCAGCTGCCTACTGCCTCGGACTTCAAGGGGCTACTTTAGGAGCAATTATCTTGTTTACTAAAA
CTGAATACCTTGCTATCTCTTTGATACATTTTTACAAAGCTGAATTAAAATGGTATAAATTAAATCACTT
TAAAACCATGTCTGTACATTTTTAGAGGGCTTCAGCAGGGCATTGAGGAGGTGCTCTGTGTATGCATAGA
ATTTGCAATATCAAAAAGAAAGTATTCGTAAGAGAAATGAGGAAATGTGTTACAGTATTTTTATTTTTTT
TAAAAGCGTAGTAGGGCAATATTTCCC
Components 1 x 10 ug vial miRNA plasmid lyophilized in a 2-D bar-coded Matrix tube
Also Contains Both mature and minor (star) miRNA can be over expressed from the construct.
OTI Disclaimer All miRNA clones were sequenced to ensure that the pre-mir sequences match reference sequence in miRBase. The flanking sequence of a miRNA clone may differ from the NCBI reference with respect to biological polymorphisms. This should not affect the function of the mature miRNA.
Shipping Ambient
Reference Data
RefSeq MI0000088
Synonyms MIRN30A
Locus ID 407029
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Co-Delivery of RUNX2-Targeting miRNAs and shRNAs Using Nanoparticles Composed of Dexamethasone and PEI Induces Chondrogenesis of Human Mesenchymal Stem Cells
Kim, Yi, Kim et al
J Biomed Nanotechnol (2019) 15 (1), 113-126 DOI: 10.1166/jbn.2019.2671
Cited by 8
AI Summary: OriGene products, specifically the Human RUNX2 TrueORF cDNA (RC211203) and Anti-RUNX2 antibody [OTI2F5] (TA804864), were used in this study to assess RUNX2 gene and protein expression, enabling evaluation of the effectiveness of miRNA and shRNA-mediated silencing in promoting chondrogenesis of human mesenchymal stem cells.
miR-30a inhibits endothelin A receptor and chemoresistance in ovarian carcinoma
Sestito, Cianfrocca, Rosanò et al
Oncotarget (2016) 7 (4), 4009-23 DOI: 10.18632/oncotarget.6546
Cited by 51
AI Summary: OriGene products contributed to this study by providing the pCMV6-ETAR expression plasmid and ETAR-specific antibodies, which were used to manipulate and detect ETAR expression in ovarian carcinoma cell experiments investigating the role of miR-30a in chemoresistance.
FigureFigureFigure
Stress Induces p38 MAPK-Mediated Phosphorylation and Inhibition of Drosha-Dependent Cell Survival
Yang, Li, She et al
Mol. Cell (2015) 57 (4), 721-34 DOI: 10.1016/j.molcel.2015.01.004
Cited by 79
AI Summary: OriGene’s pCMV-miR-30a plasmid was used in this study to investigate the role of miR-30a in the regulation of Drosha-dependent cell survival under stress conditions.
Snippet: pCMV-miR-30a was purchased from OriGene. Anti-N’-Drosha antibody was purchased from Abcam (ab12286), and antibodies to phospho S/P (2325), phospho p38 (9211), C’-Drosha (3364s), and cleaved caspase 3 (9664) from Cell Signaling (9542)
Showing 1-3 of 3 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products