OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

MIR218-1 Human MicroRNA Expression Plasmid (MI0000294)

Be the first to review this product
SKU
SC400282
Expression plasmid for human microRNA MIR218-1
  $424.00
In Stock*

Frequently Bought Together (1)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00

Other products for "MIR218-1 or MI0000294"

Specifications
Specifications
Product Data
Species Human
Vector pCMV-MIR
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequences
Precursor: GUGAUAAUGUAGCGAGAUUUUCUGUUGUGCUUGAUCUAACCAUGUGGUUGCGAGGUAUGAGUAAAACAUGGUUCCGUCAAGCACCAUGGAACGUCACGCAGCUUUCUACA:
Mature Sequence: UUGUGCUUGAUCUAACCAUGU:
Full Insert
>MI0000294 CTCTGTTGTCCTTGTAGCTCACCTTCAACTTCTTCCTGGATGTTGTTCCCGAAAGCTGTTGTTTCCATTC
TGCAGTTCTGAGGAATGGTGGAGGCACCTTTTCCATATAGCCCCTTCTTTGTGTTTCCAGGAAATCATCG
GTAGTAATACTCTTACTGTGGTCATAAACATTCTGCGGGAAGAATGCATGTCATGTAAACAGTATTACGT
TTCCAGAACGTCTGTAGCTTTTCTCCTCCTTCCCTCCATTTTCCTCTTGGTCTTACCTTTGGCCTAGTGG
TTGGTGTAGTGATAATGTAGCGAGATTTTCTGTTGTGCTTGATCTAACCATGTGGTTGCGAGGTATGAGT
AAAACATGGTTCCGTCAAGCACCATGGAACGTCACGCAGCTTTCTACAGCATGACAAGCTGCTGAGGCTT
AAATCAGGATTTTCCTGTCTCTTTCTACAAAATCAAAATGAAAAAAGAGGGCTTTTTAGGCATCTCCGAG
ATTATGTGAGAGGGAGAGAATAGTAAAAAGTCCATAGAAAATTTAAAAGCCTGAGTATATCTATTTGCCT
TGAAAGCCCTAATTTACAATGAGATATAGGATCATGTTTATTACTGGATATATTTTCAATTCTTGACTCC
GAGAAAAAAAATAAACTTTTTAATAATTAATATCCATTGTGTGACTAGCTGTGAAGTAGGC
Components 1 x 10 ug vial miRNA plasmid lyophilized in a 2-D bar-coded Matrix tube
Also Contains Both mature and minor (star) miRNA can be over expressed from the construct.
OTI Disclaimer All miRNA clones were sequenced to ensure that the pre-mir sequences match reference sequence in miRBase. The flanking sequence of a miRNA clone may differ from the NCBI reference with respect to biological polymorphisms. This should not affect the function of the mature miRNA.
Shipping Ambient
Reference Data
RefSeq MI0000294
Synonyms MIRN218-1 mir-218-1
Locus ID 407000
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

miR-23b and miR-218 silencing increase Muscleblind-like expression and alleviate myotonic dystrophy phenotypes in mammalian models
Cerro-Herreros, Sabater-Arcis, Fernandez-Costa et al
Nat Commun (2018) 9 (1), 2482 DOI: 10.1038/s41467-018-04892-4
AI Summary: OriGene’s pCMV-MIR-GFP vector and miRNA plasmids were used to overexpress specific miRNAs in HeLa cells, enabling the authors to identify and validate miR-23b and miR-218 as regulators of Muscleblind-like proteins in their study of myotonic dystrophy.
Snippet: the miRNA overexpression assay, HeLa cells were seeded in 6-well plates at approximately 80% confluence and transfected with 1 µg of miRNA precursor sequences cloned into the pCMV-MIR-GFP vector (OriGene). At 48 h post-transfection, the cells were harvested for the qRT-PCR and western blot analyses. For the reporter assays, the cells were seeded in 24-well plates at approximately 80% conflue;For e...
FigureFigureFigure
microRNA-218 inhibits prostate cancer cell growth and promotes apoptosis by repressing TPD52 expression
Han, Fan, Zhang
Biochem. Biophys. Res. Commun. (2014)
Cited by 58
AI Summary: OriGene products contributed to this study by providing the human miR-218 and TPD52 expression vectors (pCMV-MIR backbone), which were used for in vitro knockdown and overexpression experiments to investigate the regulatory relationship between miR-218 and TPD52 in prostate cancer cells.
Snippet: 2 -ΔΔCT method was used to determine the relative quantitation of miR-218 levels. 2.5. In vitro knockdown and overexpression of miR-218 and TPD52. Human miR-218 and TPD-52 expression vector with a pCMV-MIR backbone was purchased from Origene. ... Cite SaveSaving
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products