OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

MIR200c Human MicroRNA Expression Plasmid (MI0000650)

Be the first to review this product
SKU
SC400258
Expression plasmid for human microRNA MIR200c
  $424.00
In Stock*

Frequently Bought Together (1)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00

Other products for "MIR200c or MI0000650"

Specifications
Specifications
Product Data
Species Human
Vector pCMV-MIR
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequences
Precursor: CCCUCGUCUUACCCAGCAGUGUUUGGGUGCGGUUGGGAGUCUCUAAUACUGCCGGGUAAUGAUGGAGG:
Mature Sequence: CGUCUUACCCAGCAGUGUUUGG:
Full Insert
>MI0000650 GGGATGAGGGTGGGTAAATCGGTGTGTGTCGCGGGTCGGGAAAGGCTGCCGGGGGTAGGGGAAGGTGGCT
CAGAGGCGGCGGGCCGACGGTCGAGGGGCTTCGGAGGGCCTGCTTGGACTGCAACCTGGGCCTCGTGATC
AGCGACCCAGGGTGTGGCTGGTGGCGGGCAGCAGGGCTCACCAGGAAGTGTCCCCAGGGACTCGGGTGGT
GGGGGGATGGGAGCCAGGGATCTGCAGCTTTTCCGCAGGGATCCTGGGCCTGAAGCTGCCTGACCCAAGG
TGGGCGGGCTGGGCGGGGGCCCTCGTCTTACCCAGCAGTGTTTGGGTGCGGTTGGGAGTCTCTAATACTG
CCGGGTAATGATGGAGGCCCCTGTCCCTGTGTCAGCAACATCCATCGCCTCAGGTCCCCAGCCCTTAGCT
GGCTGCAGCCCCCTCCCCACTTCCCACGCACCCCGGAAGCCCCTCGTCTTGAGCTGAGAGCGTTGCACAA
GGGGTGGTTCTTGTTGGCTGGCTGCCACTAAGGGACACAATGGGCCCCAGCCCCTCCTCCCACCCAGTGC
GATTTGTCACCTGGTGGATCCAGAACCCACAGTCGACCTTGAGCTTGGGGTTGGCTCGCCCCCTCTCAAG
AGACCTCACCTGG
Components 1 x 10 ug vial miRNA plasmid lyophilized in a 2-D bar-coded Matrix tube
Also Contains Both mature and minor (star) miRNA can be over expressed from the construct.
OTI Disclaimer All miRNA clones were sequenced to ensure that the pre-mir sequences match reference sequence in miRBase. The flanking sequence of a miRNA clone may differ from the NCBI reference with respect to biological polymorphisms. This should not affect the function of the mature miRNA.
Shipping Ambient
Reference Data
RefSeq MI0000650
Synonyms MIRN200C
Locus ID 406985
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

MiR-200c-3p Contrasts PD-L1 Induction by Combinatorial Therapies and Slows Proliferation of Epithelial Ovarian Cancer through Downregulation of β-Catenin and c-Myc
Anastasiadou, Messina, Sanavia et al
Cells (2021) 10 (3) DOI: 10.3390/cells10030519
Cited by 44
AI Summary: In this study, OriGene products including the human c-Myc (NM_002467) and β-catenin (NM_001904) expression plasmids were used to investigate the regulatory effects of miR-200c-3p on these oncogenes in ovarian cancer cells, helping to elucidate how miR-200c-3p downregulates c-Myc and β-catenin to counteract therapy-induced PD-L1 expression and tumor proliferation.
FigureFigureFigure
MiR-200c-3p Contrasts PD-L1 Induction by Combinatorial Therapies and Slows Proliferation of Epithelial Ovarian Cancer through Downregulation of β-Catenin and c-Myc
Anastasiadou, Messina, Sanavia et al
Cells (2021) 10 (3), 519 DOI: 10.3390/cells10030519
Cited by 44
AI Summary: In this study, OriGene’s pCMVmiR-200c (Cat. No. SC400258) and the corresponding empty vector pCMV (PCMVMIR) were used to transfect ovarian cancer cells, enabling the investigation of miR-200c-3p’s role in regulating oncogene expression and response to therapies.
Snippet: … Several studies show that these therapies might favor oncogenic signaling and impede Cached;- After 24 h, they were transfected with 1 µg of pCMVmiR-200c carrying the miR-200c precursor (pre-miR- 200c) (OriGene Technologies, Inc., Rockville, USA;Cat.n.SC400258) and the corresponding empty vector, pCMV (OriGene;PCMVMIR)
MiR-200c sensitizes Olaparib-resistant ovarian cancer cells by targeting Neuropilin 1
Vescarelli, Gerini, Megiorni et al
J. Exp. Clin. Cancer Res. (2020) 39 (1), 3 DOI: 10.1186/s13046-019-1490-7
Cited by 77
AI Summary: In this study, OriGene products—including the NRP1 shRNA (SR321712) and NRP1 antibody (TA328406)—were used to selectively inhibit and detect Neuropilin 1, respectively, enabling the authors to demonstrate that miR-200c restores Olaparib sensitivity in resistant ovarian cancer cells by targeting NRP1.
Snippet: platelet-derived growth factor (PDGF) in megakaryocytes and the keratinocyte growth factor (KGF) in adipose-derived mesenchymal stem cells [23–25]. NRP1 has been shown to play a critical role in tumorigenesis, cancer invasion and angiogenesis, through the activation of VEGF, PI3K, and AKT pathways [26, 27]. NRP1 protein is highly expressed in different cancer types, such as breast [28], colorect;;...
FigureFigureFigure
FUS Regulates Activity of MicroRNA-Mediated Gene Silencing
Zhang, Wu, Mullane et al
Mol. Cell (2018) 69 (5), 787-801.e8 DOI: 10.1016/j.molcel.2018.02.001
AI Summary: OriGene products pCMV-hsa-miR-505 (SC400432) and pCMV-hsa-miR-200c (SC400258) were used as microRNA expression plasmids to investigate the role of FUS in regulating microRNA-mediated gene silencing in this study.
Snippet: pCMV-hsa-miR-505 Origene SC400432 pCMV-has-miR-200c Origene SC400258
Figure
Re-expression of miR-200c suppresses proliferation, colony formation and in vivo tumor growth of murine claudin-low mammary tumor cells
Jones, Watson, Bruce et al
Oncotarget (2017) 8 (14), 23727-23749 DOI: 10.18632/oncotarget.15829
Snippet: The microRNA expression plasmid containing murine miR-200c was purchased from Origene (cat # SC400903;Origene Technologies, Rockville, MD)
FigureFigureFigure
Showing 1-5 of 5 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products