OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

MIR200B Human MicroRNA Expression Plasmid (MI0000342)

Be the first to review this product
SKU
SC400257
Expression plasmid for human microRNA MIR200B
  $424.00
In Stock*

Frequently Bought Together (1)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00

Other products for "MIR200B or MI0000342"

Specifications
Specifications
Product Data
Species Human
Vector pCMV-MIR
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequences
Precursor: CCAGCUCGGGCAGCCGUGGCCAUCUUACUGGGCAGCAUUGGAUGGAGUCAGGUCUCUAAUACUGCCUGGUAAUGAUGACGGCGGAGCCCUGCACG:
Mature Sequence: CAUCUUACUGGGCAGCAUUGGA:
Full Insert
>MI0000342 AGGGAAGGTCCCCCGCAGAGGGGTGGGGGCAGAGGGCCGAGCGGGGCGGGCAGAGGGCCCGTGTCAGCCC
CACTCCGACCTAGTCCTCGGCCGTCTGGCCAGGACACTTCGGCCCCCCAGGTGCCCACCCCAGGACCCAA
AGCTGGTGGCTGCTGGACTCGGCAGGGCTGGCGGGTGGGGCTCACCCGGGCCCCTGCCCTCCGGCGATGC
TGTCCTCAGTGCCCCAGGAGGACGAGGCCCCCCAGCTACTGAGCTTCCCAGCGAGTCCCATGCAACCCTC
AGCCGGGCGGCCCCCGGACCCAGCTCGGGCAGCCGTGGCCATCTTACTGGGCAGCATTGGATGGAGTCAG
GTCTCTAATACTGCCTGGTAATGATGACGGCGGAGCCCTGCACGCAGCGACCGGCCGACCCCGTCCCGGC
CCCCAGGGCCTCCCGCCGAGCCCCACACTCCCCTCCCACACAGCCCGCTCACCGGACCCCACCCCGTCCG
GGCCAGATGGCTCTGGGGAGAGTGACGGGGGGACGTGACCTTCGGAAGGGGGCTGGGGCGCCCCCCACCA
GCATCTCAGAGACCCCGGAATGCAAGGCCTCCTGCAGCTGCACCCAGGGCGCCCCACAGTGATCTGGGGA
TTAGGACGCTCAGGTGTCCGGGCCCTGCCCACAGCGCCTGGGCGGGAGCTGCTGTCACACCCA
Components 1 x 10 ug vial miRNA plasmid lyophilized in a 2-D bar-coded Matrix tube
Also Contains Both mature and minor (star) miRNA can be over expressed from the construct.
OTI Disclaimer All miRNA clones were sequenced to ensure that the pre-mir sequences match reference sequence in miRBase. The flanking sequence of a miRNA clone may differ from the NCBI reference with respect to biological polymorphisms. This should not affect the function of the mature miRNA.
Shipping Ambient
Reference Data
RefSeq MI0000342
Synonyms MIRN200B
Locus ID 406984
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Inositol Requiring Enzyme 1 Facilitates Diabetic Wound Healing through Modulating microRNAs
Wang, Qiu, Yang et al
Diabetes (2016)
Cited by 69
AI Summary: OriGene’s pCMV-miR vector and pre-miR-200 and pre-miR-466 constructs were used to express specific microRNAs in the study, enabling the investigation of how these microRNAs, regulated by IRE1α, affect angiogenesis and wound healing in diabetic conditions.
Snippet: expressing pre-miR-200 or pre-miR-466 were constructed by inserting human pre-miR-200 and pre-466 sequence into pCMV-miR vector between SgfI and MluI site (Origene). ... 8 from Origene) were used as template for PCR amplification of the linearized DNAs containing ... Cite SaveSaving
Hypoxia represses microRNA biogenesis proteins in breast cancer cells
Bandara, Michael, Gleadle
BMC Cancer (2014) 14 (1), 533 DOI: 10.1186/1471-2407-14-533
Cited by 40
AI Summary: OriGene’s pCMV-miR-200b plasmid and control empty vector were used to over-express miR-200b in breast cancer cells, enabling the study of hypoxia's effects on microRNA biogenesis proteins.
Snippet: mir-200 family. To over-express miR-200b levels we used a plasmid expressing a precursor miR-200b from a CMV promoter (pCMV-miR-200b) and an empty vector was used as the control plasmid (Origene). The RL reporter ... Cite SaveSaving
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products