OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

MIR16-1 Human MicroRNA Expression Plasmid (MI0000070)

Be the first to review this product
SKU
SC400199
Expression plasmid for human microRNA MIR16-1
  $424.00
In Stock*

Frequently Bought Together (1)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00

Other products for "MIR16-1 or MI0000070"

Specifications
Specifications
Product Data
Species Human
Vector pCMV-MIR
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequences
Precursor: GUCAGCAGUGCCUUAGCAGCACGUAAAUAUUGGCGUUAAGAUUCUAAAAUUAUCUCCAGUAUUAACUGUGCUGCUGAAGUAAGGUUGAC:
Mature Sequence: UAGCAGCACGUAAAUAUUGGCG:
Full Insert
>MI0000070 ATCTCCTTAAAAATAATTATGCATATTACATCAATGTTATAATGTTTAAACATAGATTTTTTTACATGCA
TTCTTTTTTTCCTGAAAGAAAATATTTTTTATATTCTTTAGGCGCGAATGTGTGTTTAAAAAAAATAAAA
CCTTGGAGTAAAGTAGCAGCACATAATGGTTTGTGGATTTTGAAAAGGTGCAGGCCATATTGTGCTGCCT
CAAAAATACAAGGATCTGATCTTCTGAAGAAAATATATTTCTTTTTATTCATAGCTCTTATGATAGCAAT
GTCAGCAGTGCCTTAGCAGCACGTAAATATTGGCGTTAAGATTCTAAAATTATCTCCAGTATTAACTGTG
CTGCTGAAGTAAGGTTGACCATACTCTACAGTTGTGTTTTAATGTATATTAATGTTACTAATGTGTTTTC
AGTTTTATTGATAGTCTTTTCAGTATTATTGATAATCTTGTTATTTTTAGTATGATTCTGTAAAAATGAA
TTAATACTAATTTTTCAGATGTATCATCTCTTAAAATACTGTAATTGCAATTTAATAATTGTATTGAATG
CCATCAAGTTTTTTTAAAAAGCTTATGCAGCATTAGAGGAATTTATTTTAATGCACATTTATATTCAACA
TAGACATTAATTCAGATTTTTACTTGGGA
Components 1 x 10 ug vial miRNA plasmid lyophilized in a 2-D bar-coded Matrix tube
Also Contains Both mature and minor (star) miRNA can be over expressed from the construct.
OTI Disclaimer All miRNA clones were sequenced to ensure that the pre-mir sequences match reference sequence in miRBase. The flanking sequence of a miRNA clone may differ from the NCBI reference with respect to biological polymorphisms. This should not affect the function of the mature miRNA.
Shipping Ambient
Reference Data
RefSeq MI0000070
Synonyms MIRN16-1 miRNA16-1
Locus ID 406950
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Muscle miR-16 deletion results in impaired insulin sensitivity and contractile function in a sex-dependent manner
Lim, Deaver, Rosa-Caldwell et al
Am J Physiol Endocrinol Metab (2022) 322 (3), E278-E292 DOI: 10.1152/ajpendo.00333.2021
Cited by 17
AI Summary: OriGene products contributed to this study by providing the pCMV-miR empty vector control (PCMVMIR) and the pCMV-miR-16 plasmid (SC400199), which were used to manipulate miR-16 expression in C2C12 myoblasts for in vitro experiments assessing the effects of miR-16 on insulin signaling and glucose uptake.
Snippet: microRNAs (miRs) are linked to various human diseases including Type 2 Diabetes Mellitus (T2DM) and emerging evidence suggests miRs may serve as potential Save;Plasmids encoding either an empty vector control (pCMV-miR;PCMVMIR, Origene, Rockville, 112 MD, USA) or miR-16 (pCMV-miR-16;SC400199, Origene) were transferred into DH5-α Escherichia coli as 113 we have previously described (18). …
microRNA-16 Is Downregulated During Insulin Resistance and Controls Skeletal Muscle Protein Accretion
Lee, Brown, Rosa et al
J. Cell. Biochem. (2015)
Cited by 62
AI Summary: OriGene products contributed to this study by providing the plasmids pCMV-miR (Cat# PCMVMIR) and pCMV-miR16 (Cat# SC400199), which were used to manipulate miR-16 expression in skeletal muscle cells to investigate its role in protein synthesis and turnover during insulin resistance.
Snippet: Plasmids encoding empty vector (pCMV-miR, Sku:PCMVMIR;pCMV) and miR-16 (pCMV-miR16, Sku:SC400199;miR-16;Origene, Rockville, MD, USA) were transformed into DH5-α Escherichia coli [Froger and Hall, 2007]. Plasmid DNA was amplified and isolated ... Cite SaveSaving
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products