OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

MIR149 Human MicroRNA Expression Plasmid (MI0000478)

Be the first to review this product
SKU
SC400186
Expression plasmid for human microRNA MIR149
  $424.00
In Stock*

Frequently Bought Together (1)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00

Other products for "MIR149 or MI0000478"

Specifications
Specifications
Product Data
Species Human
Vector pCMV-MIR
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequences
Precursor: GCCGGCGCCCGAGCUCUGGCUCCGUGUCUUCACUCCCGUGCUUGUCCGAGGAGGGAGGGAGGGACGGGGGCUGUGCUGGGGCAGCUGGA:
Mature Sequence: UCUGGCUCCGUGUCUUCACUCCC:
Full Insert
>MI0000478 TTGCTCTCCATTCAGAAAGGCCCCAGCCCCTGGCATTCTTCCAGGAGGGGGCTTGCTTTGCCGCCCTGCA
GGGGGACTCTGCAGAGCCGGCCTCTGCCATCTCATGTCCAGGACCACAACCTGTGGCCCCGGCCTGCGCC
GGGCCGGAGCTCCGCAGAAGGAAGCCAGCGGGAGGCCTCCTGCCTTTGACTGCCGTGCGTCCAGCCTGCA
GCGGGCCTCAGGGGGCCGCCTCGATCCAGCCTGCCCGAGGCTCCCAGGCCTTCGCCCGCCTTGCGTCCAG
CCTGCCGGGGGCTCCCAGGCCGGCGCCCGAGCTCTGGCTCCGTGTCTTCACTCCCGTGCTTGTCCGAGGA
GGGAGGGAGGGACGGGGGCTGTGCTGGGGCAGCTGGAACAACGCAGGTCGCCGGGCCGGCTGGGCGAGTT
GGCCGGGCGGGGCTGAGGGGTCGGCGGGGGAGGCTGAGGCGCGGGGGCCGGTGCGCGGCCGTGAGGGGGT
GTGAGAGGTGGCTGACGGCGCCGAGGAGCCCCTCAGAACCTGCAGGTGGGGGGAGCTCCCATATCTTACG
GGTGTTTCGGGCCTCACCTCTCCATGCCTCTCGTCAGCCTCTCCCGTCTGCGTGGTGGGGGCTGGGGAGT
GGGTCCGCCGGGACCTCGCGAGGGAGGGGCACAGGA
Components 1 x 10 ug vial miRNA plasmid lyophilized in a 2-D bar-coded Matrix tube
Also Contains Both mature and minor (star) miRNA can be over expressed from the construct.
OTI Disclaimer All miRNA clones were sequenced to ensure that the pre-mir sequences match reference sequence in miRBase. The flanking sequence of a miRNA clone may differ from the NCBI reference with respect to biological polymorphisms. This should not affect the function of the mature miRNA.
Shipping Ambient
Reference Data
RefSeq MI0000478
Synonyms MIRN149
Locus ID 406941
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

miR-149-PARP-2 Signaling Regulates E-cadherin and N-cadherin Expression in the Murine Model of Endometrium Receptivity
Verma, Soni, Chadchan et al
Reprod Sci (2021)
Cited by 14
AI Summary: OriGene products, specifically the human-specific miR-149 plasmid vector (SC400186) and control vector (PCMVMIR), were used to investigate the epigenetic regulation of PARP-2 and its downstream effects on E-cadherin and N-cadherin expression in endometrial epithelial cells.
Snippet: medium. The human-specific miR-149 plasmid vector (SC400186) and control vector (PCMVMIR) were purchased from OriGene Technologies, Inc., MD, USA, and were propagated in E. coli DH5α (New England Biolabs, MA, USA)
miRNA-149 targets PARP-2 in endometrial epithelial and stromal cells to regulate the trophoblast attachment process
Soni, Chadchan, Gupta et al
Mol Hum Reprod (2021) 27 (6) DOI: 10.1093/molehr/gaab039
Cited by 16
AI Summary: OriGene products, specifically the human-specific miR-149 plasmid vector (SC400186) and the control vector (PCMVMIR), were used in this study to manipulate miR-149 expression in endometrial cells, enabling the researchers to investigate the role of miR-149 in regulating PARP-2 and trophoblast attachment during embryo implantation.
Snippet: Page 8. 8 156 The human-specific miR-149 plasmid vector (SC400186) and control vector (PCMVMIR) 157 were purchased from OriGene Technologies, Inc., MD, USA and propagated in E. coli DH5α 158 (New England Biolabs, MA, USA)
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products