MIR126 Human MicroRNA Expression Plasmid (MI0000471)
Specifications
| Product Data | |
| Species | Human |
|---|---|
| Vector | pCMV-MIR |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequences |
Precursor:
CGCUGGCGACGGGACAUUAUUACUUUUGGUACGCGCUGUGACACUUCAAACUCGUACCGUGAGUAAUAAUGCGCCGUCCACGGCA:
Mature Sequence:
CAUUAUUACUUUUGGUACGCG:
Full Insert
>MI0000471
CCAACCCGACAGGTAAACAGCCCTGGCTGTGCCTGGCCTGGGGAGGCGGGCAGGCAGTGGACATTGCCGT
GTGGCTGTTAGGCATGGTGGGGGGCACTGGAATCTGGGCGGAAGGCGGTGGGGACTCCCTCTCCAGGGAG GGAGGATGGGGAGGGAGGATAGGTGGGTTCCCGAGAACTGGGGGCAGGTTGCCCGGAGCCTCATATCAGC CAAGAAGGCAGAAGTGCCCCGTCCCGGGGTCCTGTCTGCATCCAGCGCAGCATTCTGGAAGACGCCACGC CTCCGCTGGCGACGGGACATTATTACTTTTGGTACGCGCTGTGACACTTCAAACTCGTACCGTGAGTAAT AATGCGCCGTCCACGGCACCGCATCGAAAACGCCGCTGAGACCTCAGCCTTGACCTCCCTCAGCGTGGCC GGGACCCTGAGCCTCTGCGCAGAGCCACCCGCCCCGACGTACTTAGGCGGCATAGCCCTGAGACCTCTGG CCAGCGCCAGGCAGGCAGCGGGGGCGGCAGAGGCCTGGGCCTGAGTCTTCTGGCTCTGCCTCTCCCTGGG GACAGGAGGGAGCCTGGGGGTGTGGGTGGGGAGCCGGCCGGCCGTGACCCAGCGCCTGGCTCTGCCCGCA GGAGTGGACAGTGCAATGAAGG |
| Components | 1 x 10 ug vial miRNA plasmid lyophilized in a 2-D bar-coded Matrix tube |
| Also Contains | Both mature and minor (star) miRNA can be over expressed from the construct. |
| OTI Disclaimer | All miRNA clones were sequenced to ensure that the pre-mir sequences match reference sequence in miRBase. The flanking sequence of a miRNA clone may differ from the NCBI reference with respect to biological polymorphisms. This should not affect the function of the mature miRNA. |
| Shipping | Ambient |
| Reference Data | |
| RefSeq | MI0000471 |
| Synonyms | MIRN126 miRNA126 |
| Locus ID | 406913 |
Reviews
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Citations
microRNA-126 inhibits vascular cell adhesion molecule-1 and interleukin-1beta in human dental pulp cells
Jiang, Krongbaramee, Lin et al
J Clin Lab Anal (2022) 36 (5), e24371 DOI: 10.1002/jcla.24371
Jiang, Krongbaramee, Lin et al
J Clin Lab Anal (2022) 36 (5), e24371 DOI: 10.1002/jcla.24371
Cited by 13
AI Summary: OriGene contributed to this study by providing the pSilencer-4.1 vector and the miR-126-specific plasmid DNA used to overexpress miR-126 in human dental pulp cells, enabling the investigation of miR-126’s role in regulating inflammation.
Snippet: h 10% FBS. 2.3 Transfection of DPCs with plasmid DNA (pDNA) encoding miR‐126 The pDNA‐encoding miR‐126 was constructed with pSilencer‐4.1 and the miR‐126‐specific sequence commercially (OriGene). pSilencer‐4.1 was used as a vector stably expressing miR‐126, and the mature sequence of miR‐126 (CAUUAUUACUUUUGGUACGCG) was synthesized by oligonucleotides. Empty pSilencer‐4.1 vect;- The pDNA- encod...
Tumor microRNA-126 controls cell viability and associates with poor survival in patients with esophageal adenocarcinoma
Toxopeus, Lynam-Lennon, Biermann et al
Exp. Biol. Med. (Maywood) (2019)
Toxopeus, Lynam-Lennon, Biermann et al
Exp. Biol. Med. (Maywood) (2019)
Snippet: To establish a stable cell line overexpressing miR-126, OE33 cells were transfected via Lipofectamine (Applied Biosystems) with 10 ng of the plasmid carrying the miR-126 sequence 5′-CGUACCGUGAGUAAUAAUGCG-or an empty plasmid as control (vector control) (OriGene, Herford, Germany). Continuous selection was carried out with 0.5 mg/mL G418 (Sigma-Aldrich, Zwijndrecht, the Netherlands) added to the cel...
MiR-126 in intestinal-type sinonasal adenocarcinomas: exosomal transfer of MiR-126 promotes anti-tumour responses
Tomasetti, Re, Monaco et al
BMC Cancer (2018) 18 (1), 896 DOI: 10.1186/s12885-018-4801-z
Tomasetti, Re, Monaco et al
BMC Cancer (2018) 18 (1), 896 DOI: 10.1186/s12885-018-4801-z
AI Summary: OriGene’s pCMV-MiR plasmid carrying the MiR-126 sequence was used to stably transfect MNSC cells, enabling the study of MiR-126’s tumor-suppressive effects in intestinal-type sinonasal adenocarcinomas.
Snippet: Ectopic MiR-126 expression. MNSC cells (2 × 10 4 per well in a 24 well plate) were stably transfected with the pCMV-MiR plasmid carrying the MiR-126 sequence 5'-UCG UAC CGU GAG UAA UAA UGC G-3′ (OriGene) using the TransIT-LT1 reagent (Mirus) Cached
Lipoxin A4 stimulates endothelial miR-126-5p expression and its transfer via microvesicles
Codagnone, Recchiuti, Lanuti et al
FASEB J. (2017)
Codagnone, Recchiuti, Lanuti et al
FASEB J. (2017)
AI Summary: In this study, the pCMV-miR-126-5p plasmid from OriGene was used to overexpress miR-126-5p in breast cancer MDA-MB-231 cells, enabling the authors to investigate the regulatory effects of miR-126-5p on SPRED1 expression.
Snippet: Breast cancer MDA-MB-231 cells, grown in DMEM supple- mented with 10% FBS, 1% L-Glu and P/S, were cotransfected with SPRED1 39UTR (pEZX-MT05;Genecopoeia, Rockville, MD, USA), plus the pCMV-miR-126-5p plasmid (Origene, Rockville, MD, USA) or an ... Cite SaveSaving
MicroRNA-126 induces autophagy by altering cell metabolism in malignant mesothelioma
Tomasetti, Monaco, Manzella et al
Oncotarget (2016) 7 (24), 36338-36352 DOI: 10.18632/oncotarget.8916
Tomasetti, Monaco, Manzella et al
Oncotarget (2016) 7 (24), 36338-36352 DOI: 10.18632/oncotarget.8916
Cited by 47
AI Summary: OriGene products, including the pCMV-MiR and pRS empty plasmids, MIR126 expression plasmid, and human IRS1 overexpression plasmid (SC124032), were used to manipulate MIR126 and IRS1 expression in malignant mesothelioma cells, enabling the study of their roles in autophagy and cell metabolism.
Snippet: Cells (2×105) were stably transfected with 1 μg of the pCMV-MiR and/or pRS (OriGene) empty plasmid or with plasmid carrying the MIR126 sequence 5′-UCG UAC CGU GAG UAA UAA UGC G-3′ (OriGene, Rockville, MD) and/or shRNA pRS plasmid, with the HIF1α-targeting sequence of 5′-ACA AGA ACC TAC TGC TAA TGC CAC CAC TA-3′, and with the acetyl-CoA citrate lyase (ACL)-targeting sequence of 5′-CCA TCA CTG AGG TCT TCA AGG AAG AGA TG-3′, using the TransIT-LT1 reagent (Mirus). Anti-IRS1 sequence 5′-AGA CCA UCA GCU UCG UGA ATT-3′ (Ambion), or human IRS1 plasmid (SC124032, OriGene), were used to transiently silence or overexpress IRS1, respectively
MicroRNA-126 Suppresses Mesothelioma Malignancy by Targeting IRS1 and Interfering with Mitochondrial Function
Tomasetti, Nocchi, Staffolani et al
Antioxid. Redox Signal. (2014)
Tomasetti, Nocchi, Staffolani et al
Antioxid. Redox Signal. (2014)
Cited by 91
AI Summary: OriGene products, specifically the pCMV-MiR and pRS plasmids, were used to stably express MiR126 and deliver shRNA constructs in mesothelioma cell lines, enabling the study of MiR126's tumor suppressor functions in this research.
Snippet: Establishment of stable cell lines expressing MiR126 and siRNA transfection Cells (2x10 5 ) were stably transfectedwith 1 μg of the pCMV-MiR and/or pRS (OriGene) ... Page 20. 20 -20- UAA UGC G-3' (OriGene) and/or shRNA pRS plasmid, with the ACL targeting sequence ... Cite SaveSaving
Showing 1-6 of 6 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.
Related Products
- Price:
- Actual Price:
Welcome to OriGene AI!
I'm your AI-powered guide to everything OriGene.
Ask me anything:
- Product specs
- Ordering help
- Technical questions
- How to find exactly what your experiment needs
Prefer a live agent? Connect with us by clicking the green chat icon, as seen in the image below or email our team at custsupport@origene.com.
