OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

MIR124-1 Human MicroRNA Expression Plasmid (MI0000443)

Be the first to review this product
SKU
SC400060
Expression plasmid for human microRNA MIR124-1
  $424.00
In Stock*

Frequently Bought Together (1)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00

Other products for "MIR124-1 or MI0000443"

Specifications
Specifications
Product Data
Species Human
Vector pCMV-MIR
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequences
Precursor: AGGCCUCUCUCUCCGUGUUCACAGCGGACCUUGAUUUAAAUGUCCAUACAAUUAAGGCACGCGGUGAAUGCCAAGAAUGGGGCUG:
Mature Sequence: CGUGUUCACAGCGGACCUUGAU:
Full Insert
>MI0000443 GCAGGAAAAAGCCTGGATGCGAAAGGATGGGGGAGAACAAAGAGCCTTTGGAAGACGTCGCTGTTATCTC
ATTGTCTGTGTGATTGGGGGAGCTGCGGCGGGGAGGATGCTGTGGTCCCTTCCTCCGGCGTTCCCCACCC
CCATCCCTCTCCCCGCTGTCAGTGCGCACGCACACGCGCCGCTTTTTATTTCTTTTTCCTGGTTTTCTTA
TTCCATCTTCTACCCACCCCTCTTCCTTTCTTTCACCTTTCCTTCCTTCCTTCCTCCTTTCCTTCCTCAG
GAGAAAGGCCTCTCTCTCCGTGTTCACAGCGGACCTTGATTTAAATGTCCATACAATTAAGGCACGCGGT
GAATGCCAAGAATGGGGCTGGCTGAGCACCGTGGGTCGGCGAGGGCCCGCCAAGGAAGGAGCGACCGACC
GAGCCAGGCGCCCTCCGCAGACCTCCGCGCAGCGGCCGCGGGCGCGAGGGGAGGGGTCTGGAGCTCCCTC
CGGCTGCCTGTCCCGCACCGGAGCCCGTGGGGTGGGGAGGTGTGCAGCCTGTGACAGACAGGGGCTTAGA
GATGCAAACAGACTCAGGGAGAGAAACAGAAGCTGATTCTGTGACAGAAGCAGATCTGTGCAGCACAGAT
GCGGTGTGCGTGGGGA
Components 1 x 10 ug vial miRNA plasmid lyophilized in a 2-D bar-coded Matrix tube
Also Contains Both mature and minor (star) miRNA can be over expressed from the construct.
OTI Disclaimer All miRNA clones were sequenced to ensure that the pre-mir sequences match reference sequence in miRBase. The flanking sequence of a miRNA clone may differ from the NCBI reference with respect to biological polymorphisms. This should not affect the function of the mature miRNA.
Shipping Ambient
Reference Data
RefSeq MI0000443
Synonyms MIR124A MIR124A1 MIRN124-1 MIRN124A1
Locus ID 406907
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

AAV-miR-124 enhances endogenous alveolar epithelial regenerative plasticity and reverses bleomycin-induced pulmonary fibrosis
Volpe, Zandomenego, Ingo et al
bioRxiv (2026)
AI Summary: OriGene’s pre-miR-124 plasmid (#SC400060) was used as the source for cloning the miR-124 sequence, enabling the researchers to generate vectors for functional studies on alveolar repair in pulmonary fibrosis.
Snippet: The pre-miR-124 sequence was subcloned from an Origene plasmid (#SC400060). 816 Amplicons were re-amplified with chimeric primers containing restriction sites 817 (EcoRI/NotI for miR-5008 and EcoRI/EcoRV-blunted for miR-124)
MicroRNA-124 suppresses Slug-mediated lung cancer metastasis
Cui, Hu
Eur Rev Med Pharmacol Sci (2016) 20 (18), 3802-3811
AI Summary: OriGene products, including miR-124 mimics, antisense oligonucleotides (as-miR-124), Slug, and shSlug, were used to modulate gene expression and investigate the role of miR-124 and Slug in lung cancer metastasis in this study.
Snippet: Louis, MO, USA) in a humidified chamber with 5% CO2 at 37 C. MiRNAs mimics(miR-124), miRNAs antisense oligonucleotides (as-miR-124), Slug, and short hairpin smallinterfering RNA for MMP (shSlug) were obtained from Origene (Beijing, China). ... Cite SaveSaving
miR-124 regulates the epithelial-restricted with serine box/epidermal growth factor receptor signaling axis in head and neck squamous cell carcinoma
Zhang, Piao, Datta et al
Mol. Cancer Ther. (2015)
AI Summary: OriGene products pCMV.MIR (miR.control) and pCMV.MIR containing the precursor miR-124 were used to generate stable cell lines for studying the effects of miR-124 on ESX/EGFR signaling in head and neck squamous cell carcinoma.
Snippet: Generation of stable cell lines. pCMV.MIR (miR.control) and pCMV.MIR containing the precursor miR.124 sequence (miR.124) were purchased from OriGene Technologies, Inc. (Rockville, MD). Endotoxin.free plasmids were transfected into SCC15 and CAL27 cells ... Cite SaveSaving
RNA viruses can hijack vertebrate microRNAs to suppress innate immunity
Trobaugh, Gardner, Sun et al
Nature (2013)
Cited by 241
AI Summary: OriGene’s pCMV-miR-142 and pCMV-miR-124 expression plasmids were used to introduce specific microRNAs into cells, enabling the study of how these miRNAs influence RNA virus replication and immune response.
Snippet: The pCMV-miR-142 expression plasmid and a neuron-specific miRNA, pCMV-miR-124, (OriGene) were electroporated (4 μg each) into BHK-21 cells (1 × 106 cells)
Systems biology of the autophagy-lysosomal pathway
Jegga, Schneider, Ouyang et al
Autophagy (2011) 7 (5), 477-89
Cited by 26
AI Summary: OriGene products, including the pCMV-SREBP1 expression vector (SC117502), control vector pCMVXL5 (PCMV6XL5), miR-124 expression vector (SC400060), and negative control vector (PCMVMIR), were used in this study to manipulate gene and microRNA expression in HEK cells for functional analyses of autophagy-lysosomal pathway regulation.
Snippet: pCMV-SREBP1 and control vec- tor pCMVXL5 are from Origene (SC117502, PCMV6XL5). ... miR-124 expression vector and negative controls from Origene (SC400060, PCMVMIR) were transfected to HEK cells and protein extracts were made 48 hrs after transfection.
Showing 1-5 of 5 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products